| Variant ID: vg0810519360 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 10519360 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCCAAATCATGGGTAGGATAGTTGCCTTCATGGGGTCGTAGCTGGCGTGAAGCATAAGCTACCACATGACCTTCTTGCATTAACACACACCCCAAACCT[T/A]
GGCACGAAGCGTCACAGTACACCAGGAAATCCTTGCGAGTATCTGATAAGATTAACACTGACGAGGAAACCAACTTTTCTTTGAGAGTTTGAAATGCTCT
AGAGCATTTCAAACTCTCAAAGAAAAGTTGGTTTCCTCGTCAGTGTTAATCTTATCAGATACTCGCAAGGATTTCCTGGTGTACTGTGACGCTTCGTGCC[A/T]
AGGTTTGGGGTGTGTGTTAATGCAAGAAGGTCATGTGGTAGCTTATGCTTCACGCCAGCTACGACCCCATGAAGGCAACTATCCTACCCATGATTTGGAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 27.70% | 7.79% | 13.03% | NA |
| All Indica | 2759 | 38.70% | 37.30% | 8.59% | 15.48% | NA |
| All Japonica | 1512 | 68.00% | 12.90% | 7.14% | 11.97% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.00% | 0.74% | NA |
| Indica I | 595 | 21.20% | 41.50% | 10.76% | 26.55% | NA |
| Indica II | 465 | 51.40% | 14.20% | 6.67% | 27.74% | NA |
| Indica III | 913 | 38.00% | 49.10% | 8.43% | 4.49% | NA |
| Indica Intermediate | 786 | 45.20% | 34.00% | 8.27% | 12.60% | NA |
| Temperate Japonica | 767 | 93.00% | 0.70% | 1.17% | 5.22% | NA |
| Tropical Japonica | 504 | 39.10% | 32.30% | 16.07% | 12.50% | NA |
| Japonica Intermediate | 241 | 49.00% | 11.20% | 7.47% | 32.37% | NA |
| VI/Aromatic | 96 | 16.70% | 67.70% | 14.58% | 1.04% | NA |
| Intermediate | 90 | 62.20% | 22.20% | 10.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810519360 | T -> A | LOC_Os08g17170.1 | intron_variant ; MODIFIER | silent_mutation | Average:24.305; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| vg0810519360 | T -> DEL | N | N | silent_mutation | Average:24.305; most accessible tissue: Minghui63 young leaf, score: 42.042 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810519360 | 1.64E-06 | 5.84E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810519360 | 1.41E-06 | NA | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810519360 | 1.90E-06 | 1.90E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810519360 | 5.43E-07 | NA | mr1104_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810519360 | 3.70E-06 | NA | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810519360 | 1.73E-06 | 5.46E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |