Variant ID: vg0810503248 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 10503248 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAGGAACTGTGTTTAGGATCTGTGTGACTTGCCTTGCAATAATCGGTCTTCAATTAGTCTTCAGAACCACTTCCGACGCACTCGCGAACCTTTCGCAAC[G/A]
ACGGAAACAACAAGCTAACACGCAAAATGGGAAAAAAGACTAATAAAAACCAAATAAACAGTACATAAAAGTAAACAAACATGTAGATCATGATTTTAGA
TCTAAAATCATGATCTACATGTTTGTTTACTTTTATGTACTGTTTATTTGGTTTTTATTAGTCTTTTTTCCCATTTTGCGTGTTAGCTTGTTGTTTCCGT[C/T]
GTTGCGAAAGGTTCGCGAGTGCGTCGGAAGTGGTTCTGAAGACTAATTGAAGACCGATTATTGCAAGGCAAGTCACACAGATCCTAAACACAGTTCCTTT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.30% | 4.70% | 0.02% | 0.00% | NA |
All Indica | 2759 | 98.50% | 1.50% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
Aus | 269 | 53.20% | 46.80% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 96.10% | 3.80% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 93.20% | 6.80% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0810503248 | G -> A | LOC_Os08g17150.1 | upstream_gene_variant ; 491.0bp to feature; MODIFIER | silent_mutation | Average:40.659; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
vg0810503248 | G -> A | LOC_Os08g17160.1 | upstream_gene_variant ; 4876.0bp to feature; MODIFIER | silent_mutation | Average:40.659; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
vg0810503248 | G -> A | LOC_Os08g17140-LOC_Os08g17150 | intergenic_region ; MODIFIER | silent_mutation | Average:40.659; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0810503248 | NA | 1.49E-06 | mr1028 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810503248 | NA | 7.02E-06 | mr1453 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810503248 | NA | 1.88E-06 | mr1648 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810503248 | NA | 7.37E-06 | mr1652 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810503248 | NA | 6.23E-07 | mr1697 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810503248 | 8.12E-06 | NA | mr1757 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0810503248 | NA | 5.54E-06 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |