\
| Variant ID: vg0810425666 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 10425666 |
| Reference Allele: C | Alternative Allele: A,CA |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 213. )
AATTGCTTATGTAGATCAGCTATCTGCAATTGCATTCTGGCTGATCCCATCTTCTCAGCATGCAATTCACTCTCTAGCTCACGTACATGATCATTCATTG[C/A,CA]
AGCAGCTTTGGCATTTTTCTTCATCTCTGTGGACTGCATGCCAACATTGCGAAGAAAAGTTGATTTTGGCAGAACATGAGCTACAGCTTCAACAGGAGTC
GACTCCTGTTGAAGCTGTAGCTCATGTTCTGCCAAAATCAACTTTTCTTCGCAATGTTGGCATGCAGTCCACAGAGATGAAGAAAAATGCCAAAGCTGCT[G/T,TG]
CAATGAATGATCATGTACGTGAGCTAGAGAGTGAATTGCATGCTGAGAAGATGGGATCAGCCAGAATGCAATTGCAGATAGCTGATCTACATAAGCAATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.70% | 17.60% | 4.66% | 0.00% | CA: 0.04% |
| All Indica | 2759 | 71.10% | 23.10% | 5.80% | 0.00% | NA |
| All Japonica | 1512 | 94.60% | 3.00% | 2.45% | 0.00% | NA |
| Aus | 269 | 46.80% | 47.60% | 5.20% | 0.00% | CA: 0.37% |
| Indica I | 595 | 82.50% | 13.90% | 3.53% | 0.00% | NA |
| Indica II | 465 | 89.70% | 6.20% | 4.09% | 0.00% | NA |
| Indica III | 913 | 50.80% | 41.50% | 7.67% | 0.00% | NA |
| Indica Intermediate | 786 | 75.10% | 18.60% | 6.36% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 0.30% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 89.10% | 6.70% | 4.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 3.70% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 13.50% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 8.90% | 4.44% | 0.00% | CA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0810425666 | C -> A | LOC_Os08g17020.1 | missense_variant ; p.Ala198Ser; MODERATE | nonsynonymous_codon ; A198S | Average:12.249; most accessible tissue: Callus, score: 25.508 | unknown | unknown | TOLERATED | 0.37 |
| vg0810425666 | C -> CA | LOC_Os08g17020.1 | frameshift_variant ; p.Ala198fs; HIGH | frameshift_variant | Average:12.249; most accessible tissue: Callus, score: 25.508 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0810425666 | NA | 1.21E-10 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 3.79E-11 | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 3.50E-10 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 2.11E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 3.83E-12 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 1.84E-10 | mr1132 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 5.66E-12 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 1.68E-12 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | 2.70E-06 | 2.28E-11 | mr1055_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | 3.30E-06 | NA | mr1132_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 3.04E-14 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | NA | 6.06E-13 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | 3.08E-07 | 4.21E-15 | mr1390_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0810425666 | 1.38E-07 | 1.34E-15 | mr1490_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |