\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810407609:

Variant ID: vg0810407609 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10407609
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTCTAATCTGTATGGTAGGATGGTATACACTTTAATGTGATCCGAGTGGCTTTTCATAAAGCAGAGATGTTGGCCTACAGAACATCTTAGAAGGAACA[T/C]
ACCTATATGAGTCCGACTGCTAGTCACAGTCTATGAGATCTTGGTGATCTCTAGATACTCATGAAAAGGCCAGGAGTATGACTTATATGCTCCAAACAGA

Reverse complement sequence

TCTGTTTGGAGCATATAAGTCATACTCCTGGCCTTTTCATGAGTATCTAGAGATCACCAAGATCTCATAGACTGTGACTAGCAGTCGGACTCATATAGGT[A/G]
TGTTCCTTCTAAGATGTTCTGTAGGCCAACATCTCTGCTTTATGAAAAGCCACTCGGATCACATTAAAGTGTATACCATCCTACCATACAGATTAGAAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.90% 9.60% 7.22% 3.22% NA
All Indica  2759 88.60% 6.70% 4.60% 0.11% NA
All Japonica  1512 76.50% 4.20% 11.18% 8.13% NA
Aus  269 19.30% 72.90% 7.81% 0.00% NA
Indica I  595 95.00% 1.30% 3.70% 0.00% NA
Indica II  465 84.90% 9.70% 5.38% 0.00% NA
Indica III  913 88.40% 7.90% 3.50% 0.22% NA
Indica Intermediate  786 86.10% 7.60% 6.11% 0.13% NA
Temperate Japonica  767 91.80% 2.10% 5.61% 0.52% NA
Tropical Japonica  504 54.60% 6.00% 21.23% 18.25% NA
Japonica Intermediate  241 73.90% 7.10% 7.88% 11.20% NA
VI/Aromatic  96 61.50% 4.20% 13.54% 20.83% NA
Intermediate  90 73.30% 7.80% 12.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810407609 T -> C LOC_Os08g17000.1 upstream_gene_variant ; 2484.0bp to feature; MODIFIER silent_mutation Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0810407609 T -> C LOC_Os08g16990.1 downstream_gene_variant ; 318.0bp to feature; MODIFIER silent_mutation Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0810407609 T -> C LOC_Os08g16990-LOC_Os08g17000 intergenic_region ; MODIFIER silent_mutation Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N
vg0810407609 T -> DEL N N silent_mutation Average:31.947; most accessible tissue: Minghui63 young leaf, score: 48.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810407609 1.58E-06 1.12E-07 mr1109_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810407609 NA 3.44E-06 mr1149_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810407609 3.95E-06 3.95E-06 mr1466_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810407609 NA 5.40E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251