\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0810250539:

Variant ID: vg0810250539 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 10250539
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TCATGTTGCATCATCTAGCATTTCTACCTCTTGTGATGATCTTATGGATATGCCTAGCTCTAGCTATAGCTCTTGTGTTTCTATTTGTGATGCCTCACTT[G/A]
TTGTTGAGAACAATGAGCTTAAGGAGCAAGTGGCCAAGCTCAACAAGAGTTTGGAGAGGTGCTTCAAGGGTAAGAACACTCTTGACAAGATTTTCAGTGA

Reverse complement sequence

TCACTGAAAATCTTGTCAAGAGTGTTCTTACCCTTGAAGCACCTCTCCAAACTCTTGTTGAGCTTGGCCACTTGCTCCTTAAGCTCATTGTTCTCAACAA[C/T]
AAGTGAGGCATCACAAATAGAAACACAAGAGCTATAGCTAGAGCTAGGCATATCCATAAGATCATCACAAGAGGTAGAAATGCTAGATGATGCAACATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 15.50% 3.66% 4.13% NA
All Indica  2759 88.00% 1.50% 4.75% 5.69% NA
All Japonica  1512 56.90% 40.40% 1.46% 1.19% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 95.80% 0.70% 1.68% 1.85% NA
Indica II  465 93.50% 1.10% 3.44% 1.94% NA
Indica III  913 78.30% 1.80% 7.23% 12.71% NA
Indica Intermediate  786 90.20% 2.20% 4.96% 2.67% NA
Temperate Japonica  767 89.30% 9.90% 0.26% 0.52% NA
Tropical Japonica  504 14.30% 81.50% 2.98% 1.19% NA
Japonica Intermediate  241 43.20% 51.50% 2.07% 3.32% NA
VI/Aromatic  96 8.30% 60.40% 16.67% 14.58% NA
Intermediate  90 67.80% 24.40% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0810250539 G -> A LOC_Os08g16760.1 missense_variant ; p.Val467Ile; MODERATE nonsynonymous_codon ; V467N Average:34.916; most accessible tissue: Zhenshan97 root, score: 49.075 probably damaging 2.212 DELETERIOUS 0.00
vg0810250539 G -> A LOC_Os08g16760.1 missense_variant ; p.Val467Ile; MODERATE nonsynonymous_codon ; V467I Average:34.916; most accessible tissue: Zhenshan97 root, score: 49.075 benign 1.116 TOLERATED 0.10
vg0810250539 G -> DEL LOC_Os08g16760.1 N frameshift_variant Average:34.916; most accessible tissue: Zhenshan97 root, score: 49.075 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0810250539 NA 3.35E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 4.74E-07 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 6.02E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 1.44E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 1.47E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 3.61E-13 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 4.87E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 5.26E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 7.47E-08 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 4.68E-08 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 2.16E-06 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 1.24E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 5.58E-08 mr1851 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 4.59E-07 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 6.18E-15 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 2.63E-10 mr1864 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 1.88E-08 mr1045_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 1.38E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 7.98E-06 mr1088_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 7.64E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 2.84E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 3.01E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 8.48E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 5.65E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 4.40E-08 mr1404_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 7.99E-13 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 7.14E-10 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 1.02E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 3.41E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 1.39E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 4.96E-08 mr1668_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 9.49E-10 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 4.96E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 2.71E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0810250539 NA 3.19E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251