\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809647546:

Variant ID: vg0809647546 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9647546
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGCACGAAACACGCAAGCGAAGAGGAAGGCGAGCCGTCGCGAACGAACAGGGAGCAGTCGCGCGAAGCGCTTCCCAAAAACCTTATTGCCGCCTTCTCC[C/T]
GGTGCAAGACGTCGAAGGCAGAGGTTCCGGAGACCTGCTCTCCCGATCGCCGGTGCACGCCGGTGAGCGGGATGGAGTAGTCTACGAGCGACGGCGCAGT

Reverse complement sequence

ACTGCGCCGTCGCTCGTAGACTACTCCATCCCGCTCACCGGCGTGCACCGGCGATCGGGAGAGCAGGTCTCCGGAACCTCTGCCTTCGACGTCTTGCACC[G/A]
GGAGAAGGCGGCAATAAGGTTTTTGGGAAGCGCTTCGCGCGACTGCTCCCTGTTCGTTCGCGACGGCTCGCCTTCCTCTTCGCTTGCGTGTTTCGTGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 6.70% 3.09% 7.07% NA
All Indica  2759 89.10% 6.40% 2.03% 2.50% NA
All Japonica  1512 81.40% 0.10% 4.70% 13.82% NA
Aus  269 46.50% 52.00% 0.74% 0.74% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 60.20% 26.00% 4.95% 8.82% NA
Indica III  913 95.60% 0.70% 2.52% 1.20% NA
Indica Intermediate  786 90.30% 6.20% 1.27% 2.16% NA
Temperate Japonica  767 91.00% 0.00% 6.52% 2.48% NA
Tropical Japonica  504 66.10% 0.00% 3.17% 30.75% NA
Japonica Intermediate  241 83.00% 0.40% 2.07% 14.52% NA
VI/Aromatic  96 37.50% 0.00% 14.58% 47.92% NA
Intermediate  90 85.60% 2.20% 3.33% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809647546 C -> T LOC_Os08g15860.1 upstream_gene_variant ; 908.0bp to feature; MODIFIER silent_mutation Average:33.723; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0809647546 C -> T LOC_Os08g15870.1 downstream_gene_variant ; 873.0bp to feature; MODIFIER silent_mutation Average:33.723; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0809647546 C -> T LOC_Os08g15860-LOC_Os08g15870 intergenic_region ; MODIFIER silent_mutation Average:33.723; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0809647546 C -> DEL N N silent_mutation Average:33.723; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809647546 NA 9.50E-06 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809647546 NA 5.63E-08 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809647546 NA 2.98E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809647546 NA 1.94E-06 mr1560 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251