\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809373030:

Variant ID: vg0809373030 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9373030
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTTCCTCCCCTTTTTCGGAACGTCGCCACCACTCGTCGTGGCAGCGGCAACAGCAGCGTCAGACGCCTCCTTGGCGACCTTCTCCTTCAGCGACGCC[G/A]
CCACCTGATGGTCCACGACTGGCCCGATGATATCAGTCAGAGGGAGAGCCTACGTTTCATGAAGTCATAATGCGATCCCGGAAGAAAAATGCAAAAGGAC

Reverse complement sequence

GTCCTTTTGCATTTTTCTTCCGGGATCGCATTATGACTTCATGAAACGTAGGCTCTCCCTCTGACTGATATCATCGGGCCAGTCGTGGACCATCAGGTGG[C/T]
GGCGTCGCTGAAGGAGAAGGTCGCCAAGGAGGCGTCTGACGCTGCTGTTGCCGCTGCCACGACGAGTGGTGGCGACGTTCCGAAAAAGGGGAGGAAATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.70% 41.00% 0.13% 13.14% NA
All Indica  2759 30.80% 64.20% 0.14% 4.86% NA
All Japonica  1512 72.60% 1.10% 0.07% 26.19% NA
Aus  269 56.90% 43.10% 0.00% 0.00% NA
Indica I  595 42.70% 57.30% 0.00% 0.00% NA
Indica II  465 68.00% 18.30% 0.22% 13.55% NA
Indica III  913 1.90% 93.50% 0.11% 4.49% NA
Indica Intermediate  786 33.60% 62.30% 0.25% 3.82% NA
Temperate Japonica  767 98.00% 0.40% 0.00% 1.56% NA
Tropical Japonica  504 34.10% 2.00% 0.20% 63.69% NA
Japonica Intermediate  241 72.20% 1.70% 0.00% 26.14% NA
VI/Aromatic  96 2.10% 13.50% 0.00% 84.38% NA
Intermediate  90 61.10% 26.70% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809373030 G -> A LOC_Os08g15400.1 missense_variant ; p.Ala203Val; MODERATE nonsynonymous_codon ; A203V Average:55.042; most accessible tissue: Minghui63 panicle, score: 71.773 benign 0.425 TOLERATED 0.13
vg0809373030 G -> DEL LOC_Os08g15400.1 N frameshift_variant Average:55.042; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809373030 NA 3.15E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 2.74E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 4.31E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 6.70E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 3.06E-06 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 1.25E-12 mr1063_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 6.38E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 2.97E-08 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 3.44E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 1.19E-09 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809373030 NA 9.70E-06 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251