Search for Variation information by Variation ID:
Detailed information for vg0809373030:
| Variant ID: vg0809373030 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 9373030 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 90. )
Flanking Sequence (100 bp) in Reference Genome:
GAATTTCCTCCCCTTTTTCGGAACGTCGCCACCACTCGTCGTGGCAGCGGCAACAGCAGCGTCAGACGCCTCCTTGGCGACCTTCTCCTTCAGCGACGCC[G/A]
CCACCTGATGGTCCACGACTGGCCCGATGATATCAGTCAGAGGGAGAGCCTACGTTTCATGAAGTCATAATGCGATCCCGGAAGAAAAATGCAAAAGGAC
Reverse complement sequence
GTCCTTTTGCATTTTTCTTCCGGGATCGCATTATGACTTCATGAAACGTAGGCTCTCCCTCTGACTGATATCATCGGGCCAGTCGTGGACCATCAGGTGG[C/T]
GGCGTCGCTGAAGGAGAAGGTCGCCAAGGAGGCGTCTGACGCTGCTGTTGCCGCTGCCACGACGAGTGGTGGCGACGTTCCGAAAAAGGGGAGGAAATTC
Allele Frequencies:
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 45.70% | 41.00% | 0.13% | 13.14% | NA |
| All Indica | 2759 | 30.80% | 64.20% | 0.14% | 4.86% | NA |
| All Japonica | 1512 | 72.60% | 1.10% | 0.07% | 26.19% | NA |
| Aus | 269 | 56.90% | 43.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 68.00% | 18.30% | 0.22% | 13.55% | NA |
| Indica III | 913 | 1.90% | 93.50% | 0.11% | 4.49% | NA |
| Indica Intermediate | 786 | 33.60% | 62.30% | 0.25% | 3.82% | NA |
| Temperate Japonica | 767 | 98.00% | 0.40% | 0.00% | 1.56% | NA |
| Tropical Japonica | 504 | 34.10% | 2.00% | 0.20% | 63.69% | NA |
| Japonica Intermediate | 241 | 72.20% | 1.70% | 0.00% | 26.14% | NA |
| VI/Aromatic | 96 | 2.10% | 13.50% | 0.00% | 84.38% | NA |
| Intermediate | 90 | 61.10% | 26.70% | 1.11% | 11.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0809373030 | G -> A | LOC_Os08g15400.1 | missense_variant ; p.Ala203Val; MODERATE | nonsynonymous_codon ; A203V | Average:55.042; most accessible tissue: Minghui63 panicle, score: 71.773 | benign  |
0.425 |
TOLERATED | 0.13 |
| vg0809373030 | G -> DEL | LOC_Os08g15400.1 | N | frameshift_variant | Average:55.042; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0809373030 | NA | 3.15E-06 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 2.74E-06 | mr1063 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 4.31E-10 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 6.70E-07 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 3.06E-06 | mr1919 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 1.25E-12 | mr1063_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 6.38E-09 | mr1221_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 2.97E-08 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 3.44E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 1.19E-09 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0809373030 | NA | 9.70E-06 | mr1994_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |