\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0809299619:

Variant ID: vg0809299619 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 9299619
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.35, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGCTTCCCGAGTACTCTTGCCTCCCTCCGACATACCAAGAAACCTGGAACTCGCTTCCAATGGGAGATGAAGCTTCTCAAGCGCTTACCCTGATGGAG[T/C]
GCATGCTAAAGCTTAAAGAGCAAGGTCTGCAAGGGGAACAAATCACTCGACACTTTATCAAGAGCCGGTTGGCGACTATCAAGGAGAGATCCCGCACCGC

Reverse complement sequence

GCGGTGCGGGATCTCTCCTTGATAGTCGCCAACCGGCTCTTGATAAAGTGTCGAGTGATTTGTTCCCCTTGCAGACCTTGCTCTTTAAGCTTTAGCATGC[A/G]
CTCCATCAGGGTAAGCGCTTGAGAAGCTTCATCTCCCATTGGAAGCGAGTTCCAGGTTTCTTGGTATGTCGGAGGGAGGCAAGAGTACTCGGGAAGCGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.30% 49.50% 0.13% 0.00% NA
All Indica  2759 29.60% 70.20% 0.14% 0.00% NA
All Japonica  1512 93.70% 6.30% 0.00% 0.00% NA
Aus  269 1.10% 98.90% 0.00% 0.00% NA
Indica I  595 30.80% 68.90% 0.34% 0.00% NA
Indica II  465 77.60% 22.40% 0.00% 0.00% NA
Indica III  913 5.70% 94.30% 0.00% 0.00% NA
Indica Intermediate  786 28.20% 71.50% 0.25% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 87.50% 12.50% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.90% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 60.00% 37.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0809299619 T -> C LOC_Os08g15290.1 missense_variant ; p.Cys207Arg; MODERATE nonsynonymous_codon ; C207R Average:54.806; most accessible tissue: Minghui63 flag leaf, score: 75.722 probably damaging -2.922 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0809299619 NA 8.71E-07 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 1.68E-23 mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 3.64E-09 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 1.42E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 1.72E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 1.63E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 9.07E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 1.24E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 6.72E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 6.40E-06 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 5.39E-07 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 5.57E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 2.42E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 5.93E-07 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 5.75E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 2.48E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0809299619 NA 9.63E-12 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251