\
| Variant ID: vg0808869093 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8869093 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAAATCCCGTATCTTGACTGGCACCTCCTCCGCTATCCCCGTCGGGTAACGGACTGACGAGTCAGCCAGTTGGAGGCGCATTGGTGTTGGTGCCAACACC[G/A]
TGAAGTTGAGCTTGTCGAAGACGTCTTTTGGCATGACGCTGACGCTGGCTCCAAGGTCGCACAAGGCCTGGTGAATTGTTGTGCCCCGATTGACCAGGTG
CACCTGGTCAATCGGGGCACAACAATTCACCAGGCCTTGTGCGACCTTGGAGCCAGCGTCAGCGTCATGCCAAAAGACGTCTTCGACAAGCTCAACTTCA[C/T]
GGTGTTGGCACCAACACCAATGCGCCTCCAACTGGCTGACTCGTCAGTCCGTTACCCGACGGGGATAGCGGAGGAGGTGCCAGTCAAGATACGGGATTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 8.50% | 3.72% | 4.70% | NA |
| All Indica | 2759 | 81.00% | 10.80% | 5.36% | 2.86% | NA |
| All Japonica | 1512 | 89.80% | 0.10% | 0.99% | 9.13% | NA |
| Aus | 269 | 59.90% | 34.90% | 4.83% | 0.37% | NA |
| Indica I | 595 | 78.30% | 4.90% | 7.39% | 9.41% | NA |
| Indica II | 465 | 92.70% | 0.00% | 6.02% | 1.29% | NA |
| Indica III | 913 | 74.70% | 22.30% | 2.41% | 0.55% | NA |
| Indica Intermediate | 786 | 83.50% | 8.10% | 6.87% | 1.53% | NA |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.39% | 1.17% | NA |
| Tropical Japonica | 504 | 81.00% | 0.00% | 1.98% | 17.06% | NA |
| Japonica Intermediate | 241 | 80.90% | 0.40% | 0.83% | 17.84% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 4.40% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808869093 | G -> A | LOC_Os08g14744.1 | missense_variant ; p.Thr506Met; MODERATE | nonsynonymous_codon ; T506M | Average:27.35; most accessible tissue: Minghui63 young leaf, score: 59.171 | benign |
0.784 |
TOLERATED | 0.07 |
| vg0808869093 | G -> DEL | LOC_Os08g14744.1 | N | frameshift_variant | Average:27.35; most accessible tissue: Minghui63 young leaf, score: 59.171 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808869093 | NA | 2.48E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808869093 | NA | 2.17E-08 | mr1557 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808869093 | NA | 1.89E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808869093 | NA | 4.93E-06 | mr1617 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808869093 | NA | 1.61E-06 | mr1944 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |