\
| Variant ID: vg0808431667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8431667 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 259. )
TAAGTTGATTTTGACCAGTATATATGAATTGATCCTGCAGGTAAAAGCAGCTGAAGATGCTAAAGCAATCTTTTCTGATCTAAGAAAGAAAGGGATATCT[G/A]
TTATTTGGAGTTGGAGGTTACTGTTGGGGTGGTGAGTGATATTAATCAACATAAAGAAGAAGCACATTAATTTGTGCATTTATAATTATACTACTACATC
GATGTAGTAGTATAATTATAAATGCACAAATTAATGTGCTTCTTCTTTATGTTGATTAATATCACTCACCACCCCAACAGTAACCTCCAACTCCAAATAA[C/T]
AGATATCCCTTTCTTTCTTAGATCAGAAAAGATTGCTTTAGCATCTTCAGCTGCTTTTACCTGCAGGATCAATTCATATATACTGGTCAAAATCAACTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.00% | 16.80% | 14.68% | 48.58% | NA |
| All Indica | 2759 | 3.60% | 24.70% | 15.04% | 56.69% | NA |
| All Japonica | 1512 | 53.50% | 0.30% | 11.24% | 34.99% | NA |
| Aus | 269 | 2.60% | 33.80% | 11.52% | 52.04% | NA |
| Indica I | 595 | 4.40% | 19.30% | 8.24% | 68.07% | NA |
| Indica II | 465 | 3.70% | 5.60% | 4.95% | 85.81% | NA |
| Indica III | 913 | 2.10% | 39.30% | 27.82% | 30.78% | NA |
| Indica Intermediate | 786 | 4.60% | 23.20% | 11.32% | 60.94% | NA |
| Temperate Japonica | 767 | 72.20% | 0.30% | 1.30% | 26.21% | NA |
| Tropical Japonica | 504 | 18.80% | 0.40% | 21.43% | 59.33% | NA |
| Japonica Intermediate | 241 | 66.40% | 0.00% | 21.58% | 12.03% | NA |
| VI/Aromatic | 96 | 10.40% | 6.20% | 66.67% | 16.67% | NA |
| Intermediate | 90 | 21.10% | 11.10% | 15.56% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808431667 | G -> A | LOC_Os08g14090.1 | missense_variant ; p.Val71Ile; MODERATE | nonsynonymous_codon ; V71I | Average:53.772; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | unknown | unknown | TOLERATED | 0.60 |
| vg0808431667 | G -> DEL | LOC_Os08g14090.1 | N | frameshift_variant | Average:53.772; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808431667 | NA | 5.88E-07 | mr1114 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | NA | 5.41E-06 | mr1115 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | NA | 7.42E-06 | mr1116 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | NA | 9.44E-06 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | NA | 1.88E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | 1.90E-06 | NA | mr1233 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | NA | 4.47E-06 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | NA | 1.13E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808431667 | NA | 4.86E-06 | mr1844 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |