\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808431667:

Variant ID: vg0808431667 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8431667
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTTGATTTTGACCAGTATATATGAATTGATCCTGCAGGTAAAAGCAGCTGAAGATGCTAAAGCAATCTTTTCTGATCTAAGAAAGAAAGGGATATCT[G/A]
TTATTTGGAGTTGGAGGTTACTGTTGGGGTGGTGAGTGATATTAATCAACATAAAGAAGAAGCACATTAATTTGTGCATTTATAATTATACTACTACATC

Reverse complement sequence

GATGTAGTAGTATAATTATAAATGCACAAATTAATGTGCTTCTTCTTTATGTTGATTAATATCACTCACCACCCCAACAGTAACCTCCAACTCCAAATAA[C/T]
AGATATCCCTTTCTTTCTTAGATCAGAAAAGATTGCTTTAGCATCTTCAGCTGCTTTTACCTGCAGGATCAATTCATATATACTGGTCAAAATCAACTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.00% 16.80% 14.68% 48.58% NA
All Indica  2759 3.60% 24.70% 15.04% 56.69% NA
All Japonica  1512 53.50% 0.30% 11.24% 34.99% NA
Aus  269 2.60% 33.80% 11.52% 52.04% NA
Indica I  595 4.40% 19.30% 8.24% 68.07% NA
Indica II  465 3.70% 5.60% 4.95% 85.81% NA
Indica III  913 2.10% 39.30% 27.82% 30.78% NA
Indica Intermediate  786 4.60% 23.20% 11.32% 60.94% NA
Temperate Japonica  767 72.20% 0.30% 1.30% 26.21% NA
Tropical Japonica  504 18.80% 0.40% 21.43% 59.33% NA
Japonica Intermediate  241 66.40% 0.00% 21.58% 12.03% NA
VI/Aromatic  96 10.40% 6.20% 66.67% 16.67% NA
Intermediate  90 21.10% 11.10% 15.56% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808431667 G -> A LOC_Os08g14090.1 missense_variant ; p.Val71Ile; MODERATE nonsynonymous_codon ; V71I Average:53.772; most accessible tissue: Zhenshan97 young leaf, score: 65.804 unknown unknown TOLERATED 0.60
vg0808431667 G -> DEL LOC_Os08g14090.1 N frameshift_variant Average:53.772; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808431667 NA 5.88E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 NA 5.41E-06 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 NA 7.42E-06 mr1116 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 NA 9.44E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 NA 1.88E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 1.90E-06 NA mr1233 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 NA 4.47E-06 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 NA 1.13E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808431667 NA 4.86E-06 mr1844 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251