\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808426459:

Variant ID: vg0808426459 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8426459
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATATACACTTCGTCTTGAAAATGTATCAAATATCACTAAAAACATTAGAAACAAATACTTTTAGTAATATTACACATCTACACGTAAAGTCACATCTTT[A/G]
AATTCATGATATATAAAGAGAAAAATACAAAATTCAGATAGACTTATAGCCTTAAAACTGTTAAATATTTTTGTTATGTCTAAACTATAATGACTATGGG

Reverse complement sequence

CCCATAGTCATTATAGTTTAGACATAACAAAAATATTTAACAGTTTTAAGGCTATAAGTCTATCTGAATTTTGTATTTTTCTCTTTATATATCATGAATT[T/C]
AAAGATGTGACTTTACGTGTAGATGTGTAATATTACTAAAAGTATTTGTTTCTAATGTTTTTAGTGATATTTGATACATTTTCAAGACGAAGTGTATATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.20% 9.90% 0.91% 7.00% NA
All Indica  2759 73.60% 14.40% 1.30% 10.73% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.07% NA
Aus  269 65.40% 21.20% 2.23% 11.15% NA
Indica I  595 80.70% 11.60% 1.18% 6.55% NA
Indica II  465 94.40% 3.40% 0.22% 1.94% NA
Indica III  913 56.50% 22.70% 2.19% 18.62% NA
Indica Intermediate  786 75.70% 13.40% 1.02% 9.92% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 5.20% 1.04% 0.00% NA
Intermediate  90 88.90% 6.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808426459 A -> G LOC_Os08g14090.1 upstream_gene_variant ; 4643.0bp to feature; MODIFIER silent_mutation Average:64.201; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0808426459 A -> G LOC_Os08g14070.1 downstream_gene_variant ; 1168.0bp to feature; MODIFIER silent_mutation Average:64.201; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0808426459 A -> G LOC_Os08g14070-LOC_Os08g14090 intergenic_region ; MODIFIER silent_mutation Average:64.201; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N
vg0808426459 A -> DEL N N silent_mutation Average:64.201; most accessible tissue: Zhenshan97 root, score: 87.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808426459 NA 9.75E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 1.86E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 9.33E-07 mr1115 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 3.41E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 8.98E-06 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 2.07E-06 NA mr1233 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 2.53E-06 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 1.40E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 2.87E-07 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 2.01E-06 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 3.34E-06 mr1844 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 NA 5.67E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808426459 9.79E-06 9.79E-06 mr1894 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251