Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808423022:

Variant ID: vg0808423022 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8423022
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TACATCAGTGAGAATTCCTAATGCTTACCAATTGCTGCATCTTGATTGCAAGCTCCAGAAAAAAATATTGTCATGATTATTGTGCCAGGGGGAGAAGTTT[C/T]
GGTTTTTTATGTGTTTTGTATGAGACCAGTGCAAGGGGATCTACATTGTTCTGGATTTTGTTTTGGTTTCAATTTTGCTGGTCCTACTACGTGTGCATAT

Reverse complement sequence

ATATGCACACGTAGTAGGACCAGCAAAATTGAAACCAAAACAAAATCCAGAACAATGTAGATCCCCTTGCACTGGTCTCATACAAAACACATAAAAAACC[G/A]
AAACTTCTCCCCCTGGCACAATAATCATGACAATATTTTTTTCTGGAGCTTGCAATCAAGATGCAGCAATTGGTAAGCATTAGGAATTCTCACTGATGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.00%	26.00%	0.06%	0.00%	NA
All Indica	2759	67.90%	32.10%	0.07%	0.00%	NA
All Japonica	1512	90.80%	9.20%	0.00%	0.00%	NA
Aus	269	39.00%	60.60%	0.37%	0.00%	NA
Indica I	595	45.70%	54.10%	0.17%	0.00%	NA
Indica II	465	84.10%	15.90%	0.00%	0.00%	NA
Indica III	913	74.80%	25.20%	0.00%	0.00%	NA
Indica Intermediate	786	66.90%	33.00%	0.13%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	81.30%	18.70%	0.00%	0.00%	NA
Japonica Intermediate	241	84.20%	15.80%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808423022	C -> T	LOC_Os08g14050.1	upstream_gene_variant ; 4457.0bp to feature; MODIFIER	silent_mutation	Average:45.437; most accessible tissue: Callus, score: 67.217	N	N	N	N
vg0808423022	C -> T	LOC_Os08g14070.1	upstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:45.437; most accessible tissue: Callus, score: 67.217	N	N	N	N
vg0808423022	C -> T	LOC_Os08g14050-LOC_Os08g14070	intergenic_region ; MODIFIER	silent_mutation	Average:45.437; most accessible tissue: Callus, score: 67.217	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808423022	NA	8.70E-11	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0808423022	NA	5.46E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	1.84E-06	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	5.75E-07	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	1.07E-07	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	4.65E-09	mr1125_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	1.21E-08	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	5.55E-07	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	3.50E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	4.57E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	3.99E-06	mr1553_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	2.18E-06	mr1566_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808423022	NA	3.41E-06	mr1924_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251