Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0808250957:

Variant ID: vg0808250957 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 8250957
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CGATTAAGTCCATTCAAGTCTCAGTAAATTCATAAAAAAGCATAGAATCCACTAAAAATGGTTTTGTTTCCTGTTTCAGTAGACTTATCAAATGTTTTGC[A/T]
TGTGTGCTTTGTTTATCGCGTAGATTTCGGCCGTTTCGTCGATCCGCGATTCCTCGAAGACGTTGCTGTGGTCCCATCAGCGTGAGAGCAAGGCAAGTCA

Reverse complement sequence

TGACTTGCCTTGCTCTCACGCTGATGGGACCACAGCAACGTCTTCGAGGAATCGCGGATCGACGAAACGGCCGAAATCTACGCGATAAACAAAGCACACA[T/A]
GCAAAACATTTGATAAGTCTACTGAAACAGGAAACAAAACCATTTTTAGTGGATTCTATGCTTTTTTATGAATTTACTGAGACTTGAATGGACTTAATCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.50%	11.70%	8.27%	62.53%	NA
All Indica	2759	1.60%	1.40%	7.36%	89.67%	NA
All Japonica	1512	46.20%	33.30%	5.03%	15.54%	NA
Aus	269	0.00%	0.00%	32.71%	67.29%	NA
Indica I	595	2.50%	1.70%	2.18%	93.61%	NA
Indica II	465	0.60%	2.60%	15.91%	80.86%	NA
Indica III	913	0.80%	0.10%	7.23%	91.89%	NA
Indica Intermediate	786	2.40%	1.90%	6.36%	89.31%	NA
Temperate Japonica	767	36.90%	53.50%	3.78%	5.87%	NA
Tropical Japonica	504	69.00%	5.80%	4.37%	20.83%	NA
Japonica Intermediate	241	27.80%	26.60%	10.37%	35.27%	NA
VI/Aromatic	96	72.90%	0.00%	15.62%	11.46%	NA
Intermediate	90	18.90%	11.10%	10.00%	60.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0808250957	A -> T	LOC_Os08g13820.1	upstream_gene_variant ; 434.0bp to feature; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0808250957	A -> T	LOC_Os08g13830.1	upstream_gene_variant ; 568.0bp to feature; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0808250957	A -> T	LOC_Os08g13810.1	downstream_gene_variant ; 2646.0bp to feature; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0808250957	A -> T	LOC_Os08g13820-LOC_Os08g13830	intergenic_region ; MODIFIER	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N
vg0808250957	A -> DEL	N	N	silent_mutation	Average:35.812; most accessible tissue: Minghui63 young leaf, score: 59.171	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0808250957	NA	1.98E-12	Plant_height	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0808250957	NA	4.37E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957	NA	9.40E-11	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957	NA	2.04E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957	NA	4.90E-06	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808250957	NA	6.79E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251