\
| Variant ID: vg0808091194 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 8091194 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCCAATGCCCAATTGTTCATCACAGAATAATAATCAAAAACACCTTTGATTTTACAAGGACGTCATCAGCAGTCCGCTTGCATAACCCAAGAACATTTG[C/T]
CTTGTCACCTGTGCAACATCAGATCCTTGAGAAGCAAAGAAGCTCACCCTCGACAAAAGAACCTCAGATTCAAGCAAATGCCACAAATTTTCACTTCATA
TATGAAGTGAAAATTTGTGGCATTTGCTTGAATCTGAGGTTCTTTTGTCGAGGGTGAGCTTCTTTGCTTCTCAAGGATCTGATGTTGCACAGGTGACAAG[G/A]
CAAATGTTCTTGGGTTATGCAAGCGGACTGCTGATGACGTCCTTGTAAAATCAAAGGTGTTTTTGATTATTATTCTGTGATGAACAATTGGGCATTGGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0808091194 | C -> T | LOC_Os08g13610.1 | upstream_gene_variant ; 1619.0bp to feature; MODIFIER | silent_mutation | Average:46.166; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0808091194 | C -> T | LOC_Os08g13620.1 | downstream_gene_variant ; 4860.0bp to feature; MODIFIER | silent_mutation | Average:46.166; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| vg0808091194 | C -> T | LOC_Os08g13600-LOC_Os08g13610 | intergenic_region ; MODIFIER | silent_mutation | Average:46.166; most accessible tissue: Zhenshan97 flag leaf, score: 60.705 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0808091194 | 2.52E-06 | 2.52E-06 | mr1281 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808091194 | NA | 5.73E-06 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808091194 | 4.09E-06 | 4.09E-06 | mr1842 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808091194 | 7.56E-07 | 9.48E-08 | mr1829_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808091194 | 1.49E-07 | 2.74E-07 | mr1842_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0808091194 | NA | 8.09E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |