\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0808039960:

Variant ID: vg0808039960 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 8039960
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGATGAAGTGGTCGCGAAGTTCCGCCCAAGTTCTAATTGTGCCACGGGGTAGCCCGTGAAGCCAGGACCGGGCAGAATCCGCTAGGGCCACAGGCAGATA[G/A]
TTTGCCATGGCTTTGCTGTCTCCTCCTGCTGCGCGAATTGCGAGGCTGTAGATGGTGAGCCAAGACTCCGGGTTAGTGGTGCCGTCATACTTCTTGATTC

Reverse complement sequence

GAATCAAGAAGTATGACGGCACCACTAACCCGGAGTCTTGGCTCACCATCTACAGCCTCGCAATTCGCGCAGCAGGAGGAGACAGCAAAGCCATGGCAAA[C/T]
TATCTGCCTGTGGCCCTAGCGGATTCTGCCCGGTCCTGGCTTCACGGGCTACCCCGTGGCACAATTAGAACTTGGGCGGAACTTCGCGACCACTTCATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 5.40% 0.15% 1.90% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 86.80% 6.80% 0.40% 5.95% NA
Aus  269 53.90% 46.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 96.50% 0.70% 0.13% 2.74% NA
Tropical Japonica  504 81.00% 16.30% 0.40% 2.38% NA
Japonica Intermediate  241 68.50% 6.60% 1.24% 23.65% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0808039960 G -> A LOC_Os08g13520.1 synonymous_variant ; p.Asn225Asn; LOW synonymous_codon Average:66.489; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N
vg0808039960 G -> DEL LOC_Os08g13520.1 N frameshift_variant Average:66.489; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0808039960 G A -0.02 -0.02 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0808039960 NA 7.23E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 1.20E-06 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 2.12E-08 mr1207 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 3.98E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 6.64E-09 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 2.03E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 5.91E-07 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 2.51E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 2.16E-07 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 4.40E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 7.27E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0808039960 NA 1.75E-16 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251