Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0807727511:

Variant ID: vg0807727511 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 7727511
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAAATAATATAGGTACGCTTTAAAAAGCGTCTCCATAATTTTGAGACGGTGCAAACAGAGACATTCCTACGACGCTTTATAAAAGCGTCCCAGTTATCT[G/A]
TGGGAGACGAAATAAAACGTCTCTATCCTACAAATAAGATGTCTCCATTGGGTTGTTTTGTTGTAGTAATTACACATGCAACCGTTTGGTTGTTTGTATC

Reverse complement sequence

GATACAAACAACCAAACGGTTGCATGTGTAATTACTACAACAAAACAACCCAATGGAGACATCTTATTTGTAGGATAGAGACGTTTTATTTCGTCTCCCA[C/T]
AGATAACTGGGACGCTTTTATAAAGCGTCGTAGGAATGTCTCTGTTTGCACCGTCTCAAAATTATGGAGACGCTTTTTAAAGCGTACCTATATTATTTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.40%	2.00%	9.31%	8.32%	NA
All Indica	2759	73.10%	0.10%	13.63%	13.08%	NA
All Japonica	1512	92.00%	5.70%	1.46%	0.86%	NA
Aus	269	91.10%	0.00%	6.69%	2.23%	NA
Indica I	595	70.30%	0.00%	23.03%	6.72%	NA
Indica II	465	72.90%	0.00%	11.18%	15.91%	NA
Indica III	913	76.00%	0.40%	8.32%	15.22%	NA
Indica Intermediate	786	72.10%	0.00%	14.12%	13.74%	NA
Temperate Japonica	767	94.10%	3.80%	1.69%	0.39%	NA
Tropical Japonica	504	91.70%	5.80%	1.19%	1.39%	NA
Japonica Intermediate	241	85.90%	11.60%	1.24%	1.24%	NA
VI/Aromatic	96	74.00%	1.00%	17.71%	7.29%	NA
Intermediate	90	81.10%	4.40%	7.78%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0807727511	G -> A	LOC_Os08g13010.1	upstream_gene_variant ; 1131.0bp to feature; MODIFIER	silent_mutation	Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0807727511	G -> A	LOC_Os08g13014.1	upstream_gene_variant ; 2759.0bp to feature; MODIFIER	silent_mutation	Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0807727511	G -> A	LOC_Os08g13010-LOC_Os08g13014	intergenic_region ; MODIFIER	silent_mutation	Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0807727511	G -> DEL	N	N	silent_mutation	Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0807727511	4.96E-06	4.96E-06	mr1065_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511	NA	6.14E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511	2.59E-07	2.44E-08	mr1109_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511	6.05E-06	2.98E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511	NA	1.40E-06	mr1457_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511	NA	1.84E-07	mr1458_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511	NA	8.82E-06	mr1813_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511	NA	2.01E-07	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251