\
| Variant ID: vg0807727511 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7727511 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTAAATAATATAGGTACGCTTTAAAAAGCGTCTCCATAATTTTGAGACGGTGCAAACAGAGACATTCCTACGACGCTTTATAAAAGCGTCCCAGTTATCT[G/A]
TGGGAGACGAAATAAAACGTCTCTATCCTACAAATAAGATGTCTCCATTGGGTTGTTTTGTTGTAGTAATTACACATGCAACCGTTTGGTTGTTTGTATC
GATACAAACAACCAAACGGTTGCATGTGTAATTACTACAACAAAACAACCCAATGGAGACATCTTATTTGTAGGATAGAGACGTTTTATTTCGTCTCCCA[C/T]
AGATAACTGGGACGCTTTTATAAAGCGTCGTAGGAATGTCTCTGTTTGCACCGTCTCAAAATTATGGAGACGCTTTTTAAAGCGTACCTATATTATTTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.40% | 2.00% | 9.31% | 8.32% | NA |
| All Indica | 2759 | 73.10% | 0.10% | 13.63% | 13.08% | NA |
| All Japonica | 1512 | 92.00% | 5.70% | 1.46% | 0.86% | NA |
| Aus | 269 | 91.10% | 0.00% | 6.69% | 2.23% | NA |
| Indica I | 595 | 70.30% | 0.00% | 23.03% | 6.72% | NA |
| Indica II | 465 | 72.90% | 0.00% | 11.18% | 15.91% | NA |
| Indica III | 913 | 76.00% | 0.40% | 8.32% | 15.22% | NA |
| Indica Intermediate | 786 | 72.10% | 0.00% | 14.12% | 13.74% | NA |
| Temperate Japonica | 767 | 94.10% | 3.80% | 1.69% | 0.39% | NA |
| Tropical Japonica | 504 | 91.70% | 5.80% | 1.19% | 1.39% | NA |
| Japonica Intermediate | 241 | 85.90% | 11.60% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 74.00% | 1.00% | 17.71% | 7.29% | NA |
| Intermediate | 90 | 81.10% | 4.40% | 7.78% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807727511 | G -> A | LOC_Os08g13010.1 | upstream_gene_variant ; 1131.0bp to feature; MODIFIER | silent_mutation | Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0807727511 | G -> A | LOC_Os08g13014.1 | upstream_gene_variant ; 2759.0bp to feature; MODIFIER | silent_mutation | Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0807727511 | G -> A | LOC_Os08g13010-LOC_Os08g13014 | intergenic_region ; MODIFIER | silent_mutation | Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0807727511 | G -> DEL | N | N | silent_mutation | Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807727511 | 4.96E-06 | 4.96E-06 | mr1065_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807727511 | NA | 6.14E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807727511 | 2.59E-07 | 2.44E-08 | mr1109_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807727511 | 6.05E-06 | 2.98E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807727511 | NA | 1.40E-06 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807727511 | NA | 1.84E-07 | mr1458_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807727511 | NA | 8.82E-06 | mr1813_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807727511 | NA | 2.01E-07 | mr1865_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |