\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807727511:

Variant ID: vg0807727511 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7727511
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAATAATATAGGTACGCTTTAAAAAGCGTCTCCATAATTTTGAGACGGTGCAAACAGAGACATTCCTACGACGCTTTATAAAAGCGTCCCAGTTATCT[G/A]
TGGGAGACGAAATAAAACGTCTCTATCCTACAAATAAGATGTCTCCATTGGGTTGTTTTGTTGTAGTAATTACACATGCAACCGTTTGGTTGTTTGTATC

Reverse complement sequence

GATACAAACAACCAAACGGTTGCATGTGTAATTACTACAACAAAACAACCCAATGGAGACATCTTATTTGTAGGATAGAGACGTTTTATTTCGTCTCCCA[C/T]
AGATAACTGGGACGCTTTTATAAAGCGTCGTAGGAATGTCTCTGTTTGCACCGTCTCAAAATTATGGAGACGCTTTTTAAAGCGTACCTATATTATTTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 2.00% 9.31% 8.32% NA
All Indica  2759 73.10% 0.10% 13.63% 13.08% NA
All Japonica  1512 92.00% 5.70% 1.46% 0.86% NA
Aus  269 91.10% 0.00% 6.69% 2.23% NA
Indica I  595 70.30% 0.00% 23.03% 6.72% NA
Indica II  465 72.90% 0.00% 11.18% 15.91% NA
Indica III  913 76.00% 0.40% 8.32% 15.22% NA
Indica Intermediate  786 72.10% 0.00% 14.12% 13.74% NA
Temperate Japonica  767 94.10% 3.80% 1.69% 0.39% NA
Tropical Japonica  504 91.70% 5.80% 1.19% 1.39% NA
Japonica Intermediate  241 85.90% 11.60% 1.24% 1.24% NA
VI/Aromatic  96 74.00% 1.00% 17.71% 7.29% NA
Intermediate  90 81.10% 4.40% 7.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807727511 G -> A LOC_Os08g13010.1 upstream_gene_variant ; 1131.0bp to feature; MODIFIER silent_mutation Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0807727511 G -> A LOC_Os08g13014.1 upstream_gene_variant ; 2759.0bp to feature; MODIFIER silent_mutation Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0807727511 G -> A LOC_Os08g13010-LOC_Os08g13014 intergenic_region ; MODIFIER silent_mutation Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N
vg0807727511 G -> DEL N N silent_mutation Average:28.41; most accessible tissue: Zhenshan97 panicle, score: 59.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807727511 4.96E-06 4.96E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511 NA 6.14E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511 2.59E-07 2.44E-08 mr1109_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511 6.05E-06 2.98E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511 NA 1.40E-06 mr1457_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511 NA 1.84E-07 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511 NA 8.82E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807727511 NA 2.01E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251