Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0807648774:

Variant ID: vg0807648774 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7648774
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAGTTCATCTGTGACGGGCTCTAGTTTAGGCCCGATTGAGATCAGTAGTCATCTGTAACGGGCTCTAGTTTAGGCCCGATTGAGGTCAGTAGTCATCTG[T/C]
GATGGGCTCTAGTTTAGGCCCGATTGAGGTCAGTAGTCATCTGTGACGGGCTATAGTTTAGGCCCGATTGAGATGTGTATCATCTGTGATGGGCTCTAGT

Reverse complement sequence

ACTAGAGCCCATCACAGATGATACACATCTCAATCGGGCCTAAACTATAGCCCGTCACAGATGACTACTGACCTCAATCGGGCCTAAACTAGAGCCCATC[A/G]
CAGATGACTACTGACCTCAATCGGGCCTAAACTAGAGCCCGTTACAGATGACTACTGATCTCAATCGGGCCTAAACTAGAGCCCGTCACAGATGAACTCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.00% 1.90% 2.01% 0.06% NA
All Indica  2759 93.40% 3.20% 3.37% 0.11% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.00% 1.70% 2.35% 0.00% NA
Indica II  465 93.80% 2.80% 3.23% 0.22% NA
Indica III  913 92.70% 3.50% 3.72% 0.11% NA
Indica Intermediate  786 92.00% 4.10% 3.82% 0.13% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807648774 T -> C LOC_Os08g12890.1 upstream_gene_variant ; 3809.0bp to feature; MODIFIER silent_mutation Average:45.807; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0807648774 T -> C LOC_Os08g12880.1 downstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:45.807; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0807648774 T -> C LOC_Os08g12880-LOC_Os08g12890 intergenic_region ; MODIFIER silent_mutation Average:45.807; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N
vg0807648774 T -> DEL N N silent_mutation Average:45.807; most accessible tissue: Minghui63 flag leaf, score: 73.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807648774 1.01E-06 NA mr1350_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807648774 3.09E-06 NA mr1350_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251