\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807387849:

Variant ID: vg0807387849 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7387849
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.22, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCCGCAATCAACATGAGTGTACTCGATGACTCCTTTACCTCTTTCTTCCCGGGATCGCGTTGTGACTTCATGTTACGCAGGCTTTCCCTCTGACGGAC[A/G]
TCATCGGGCCGCTCGCGGACCATTAGGCGGTGGCGTCATTGAAGGAGGGCGTCACCAAGGAGGCGTCCGATGTCGTTGCTGCCGCTACCACGAGCGGCAG

Reverse complement sequence

CTGCCGCTCGTGGTAGCGGCAGCAACGACATCGGACGCCTCCTTGGTGACGCCCTCCTTCAATGACGCCACCGCCTAATGGTCCGCGAGCGGCCCGATGA[T/C]
GTCCGTCAGAGGGAAAGCCTGCGTAACATGAAGTCACAACGCGATCCCGGGAAGAAAGAGGTAAAGGAGTCATCGAGTACACTCATGTTGATTGCGGCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.90% 31.30% 5.95% 16.89% NA
All Indica  2759 23.70% 38.60% 10.00% 27.69% NA
All Japonica  1512 96.60% 1.90% 0.07% 1.46% NA
Aus  269 1.10% 98.10% 0.37% 0.37% NA
Indica I  595 44.50% 13.10% 12.61% 29.75% NA
Indica II  465 14.20% 54.60% 5.38% 25.81% NA
Indica III  913 13.80% 42.10% 12.81% 31.33% NA
Indica Intermediate  786 25.10% 44.40% 7.51% 23.03% NA
Temperate Japonica  767 97.10% 0.70% 0.13% 2.09% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 94.20% 3.30% 0.00% 2.49% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 51.10% 33.30% 3.33% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807387849 A -> G LOC_Os08g12490.1 intron_variant ; MODIFIER silent_mutation Average:57.166; most accessible tissue: Minghui63 flag leaf, score: 93.371 N N N N
vg0807387849 A -> DEL N N silent_mutation Average:57.166; most accessible tissue: Minghui63 flag leaf, score: 93.371 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0807387849 A G 0.0 0.0 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807387849 NA 2.84E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807387849 NA 8.41E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807387849 NA 3.98E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807387849 NA 8.34E-06 mr1270_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807387849 NA 5.07E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807387849 2.83E-06 NA mr1828_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807387849 8.08E-06 NA mr1828_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251