\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0807152208:

Variant ID: vg0807152208 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 7152208
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CCCAACCCCACCTACGGCCGGAACCTCCGGGACAGGTAGGCAGGATTGAGCCCCCTAGCAGCAGGACACCAGCCCTGTGCCATGACATCTCGACTACCGG[A/G]
CCGCAGCTCGTGTAGCCTTCATTTGTCCCAGAGATGTCCATCGACCCCCGACTTCGTCCATCTCCATCCGTGTACTTTTGTTTATAACCAGACTGAGCCA

Reverse complement sequence

TGGCTCAGTCTGGTTATAAACAAAAGTACACGGATGGAGATGGACGAAGTCGGGGGTCGATGGACATCTCTGGGACAAATGAAGGCTACACGAGCTGCGG[T/C]
CCGGTAGTCGAGATGTCATGGCACAGGGCTGGTGTCCTGCTGCTAGGGGGCTCAATCCTGCCTACCTGTCCCGGAGGTTCCGGCCGTAGGTGGGGTTGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.50% 2.30% 29.60% 35.55% NA
All Indica  2759 2.10% 3.90% 42.73% 51.25% NA
All Japonica  1512 95.00% 0.00% 1.98% 2.98% NA
Aus  269 0.00% 0.00% 37.17% 62.83% NA
Indica I  595 1.30% 0.80% 12.77% 85.04% NA
Indica II  465 3.90% 5.80% 50.75% 39.57% NA
Indica III  913 1.80% 4.30% 56.52% 37.46% NA
Indica Intermediate  786 2.20% 4.60% 44.66% 48.60% NA
Temperate Japonica  767 93.90% 0.00% 1.30% 4.82% NA
Tropical Japonica  504 96.20% 0.00% 2.58% 1.19% NA
Japonica Intermediate  241 96.30% 0.00% 2.90% 0.83% NA
VI/Aromatic  96 4.20% 3.10% 70.83% 21.88% NA
Intermediate  90 40.00% 1.10% 24.44% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0807152208 A -> G LOC_Os08g12130.1 downstream_gene_variant ; 2663.0bp to feature; MODIFIER silent_mutation Average:18.312; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0807152208 A -> G LOC_Os08g12140.1 intron_variant ; MODIFIER silent_mutation Average:18.312; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg0807152208 A -> DEL N N silent_mutation Average:18.312; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0807152208 NA 5.59E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 9.18E-22 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 2.77E-34 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.51E-24 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 5.44E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 8.92E-29 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 8.74E-52 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 8.96E-10 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 8.98E-30 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 4.67E-15 mr1228 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 2.56E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 4.79E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 3.57E-34 mr1350 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 3.19E-25 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 3.45E-42 mr1480 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.59E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.13E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 2.76E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.57E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 7.65E-15 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.10E-50 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 7.32E-59 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.60E-21 mr1698 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 9.24E-19 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.17E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 3.71E-78 mr1934 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 4.73E-58 mr1935 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 6.85E-17 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.80E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 5.79E-19 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 3.11E-110 mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 3.78E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 2.57E-61 mr1402_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.68E-33 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 3.07E-25 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 2.67E-98 mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 5.51E-35 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0807152208 NA 1.41E-20 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251