\
| Variant ID: vg0807128963 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 7128963 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, A: 0.35, others allele: 0.00, population size: 72. )
CCCCACGTGGTACGAGAGGCTAGGAGGAAAGCATTTCCCGGGATTCCATGGATTCTCTCCGTTGAGCTCTCTACTTTGCACACTAGGCTGCAAGCTTGAC[A/T]
TGGTGTGAGGAGGCTGGTTTAGCGATGTCTGCCCTGCTAAACCAAGGGAAGGGGCTTCTTTGACATATACCCATGGACAATTCAGGGCATAGTGTCCCTG
CAGGGACACTATGCCCTGAATTGTCCATGGGTATATGTCAAAGAAGCCCCTTCCCTTGGTTTAGCAGGGCAGACATCGCTAAACCAGCCTCCTCACACCA[T/A]
GTCAAGCTTGCAGCCTAGTGTGCAAAGTAGAGAGCTCAACGGAGAGAATCCATGGAATCCCGGGAAATGCTTTCCTCCTAGCCTCTCGTACCACGTGGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.00% | 20.20% | 30.41% | 13.44% | NA |
| All Indica | 2759 | 9.60% | 31.90% | 41.03% | 17.47% | NA |
| All Japonica | 1512 | 89.90% | 0.90% | 1.59% | 7.67% | NA |
| Aus | 269 | 8.60% | 13.40% | 75.09% | 2.97% | NA |
| Indica I | 595 | 22.70% | 12.80% | 35.97% | 28.57% | NA |
| Indica II | 465 | 8.20% | 16.60% | 49.25% | 26.02% | NA |
| Indica III | 913 | 2.10% | 53.20% | 38.12% | 6.57% | NA |
| Indica Intermediate | 786 | 9.30% | 30.70% | 43.38% | 16.67% | NA |
| Temperate Japonica | 767 | 83.40% | 0.50% | 1.43% | 14.60% | NA |
| Tropical Japonica | 504 | 96.40% | 1.40% | 1.98% | 0.20% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.80% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 8.30% | 14.60% | 54.17% | 22.92% | NA |
| Intermediate | 90 | 48.90% | 13.30% | 30.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0807128963 | A -> T | LOC_Os08g12110.1 | missense_variant ; p.Met410Lys; MODERATE | nonsynonymous_codon ; M410K | Average:16.669; most accessible tissue: Callus, score: 38.257 | probably damaging |
-2.373 |
TOLERATED | 1.00 |
| vg0807128963 | A -> DEL | LOC_Os08g12110.1 | N | frameshift_variant | Average:16.669; most accessible tissue: Callus, score: 38.257 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0807128963 | NA | 2.89E-43 | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 2.61E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 1.38E-45 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 3.95E-35 | mr1402 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 3.10E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 2.27E-20 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 1.11E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | 2.84E-06 | 1.11E-38 | mr1828 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 2.61E-22 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 8.13E-08 | mr1004_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 6.68E-31 | mr1105_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 1.84E-16 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 1.63E-52 | mr1194_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 2.76E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 7.22E-12 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 2.34E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0807128963 | NA | 3.90E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |