| Variant ID: vg0806502338 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6502338 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATTCCTTCTTCTTTTGCCTCAAAGGATTTGTTAACATGACTTGCCACCAGCTTGGAGTCTGTTCGGATGAGCAAGCGCCGAACCCCCAAAGCTTTCGCC[A/T]
TTCTTAGGCCCAAAAGCATAGCTCGTATTCGGCCGTATTGTTGGTCATGTCAAACTGCAGCCTTGCGGCATACCGAATGGGCGCGCCCCTTGGCGAAGTG
CACTTCGCCAAGGGGCGCGCCCATTCGGTATGCCGCAAGGCTGCAGTTTGACATGACCAACAATACGGCCGAATACGAGCTATGCTTTTGGGCCTAAGAA[T/A]
GGCGAAAGCTTTGGGGGTTCGGCGCTTGCTCATCCGAACAGACTCCAAGCTGGTGGCAAGTCATGTTAACAAATCCTTTGAGGCAAAAGAAGAAGGAATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.60% | 1.20% | 13.37% | 12.78% | NA |
| All Indica | 2759 | 56.40% | 2.00% | 22.00% | 19.54% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.00% | 0.86% | NA |
| Aus | 269 | 95.90% | 0.00% | 3.72% | 0.37% | NA |
| Indica I | 595 | 67.90% | 0.50% | 11.43% | 20.17% | NA |
| Indica II | 465 | 65.60% | 0.20% | 27.10% | 7.10% | NA |
| Indica III | 913 | 36.80% | 4.70% | 28.04% | 30.45% | NA |
| Indica Intermediate | 786 | 65.10% | 1.10% | 19.97% | 13.74% | NA |
| Temperate Japonica | 767 | 99.10% | 0.00% | 0.00% | 0.91% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 45.80% | 1.00% | 8.33% | 44.79% | NA |
| Intermediate | 90 | 82.20% | 1.10% | 7.78% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806502338 | A -> T | LOC_Os08g11050.1 | missense_variant&splice_region_variant ; p.Met740Lys; MODERATE | nonsynonymous_codon ; M740K | Average:46.732; most accessible tissue: Minghui63 flag leaf, score: 88.574 | unknown | unknown | TOLERATED | 1.00 |
| vg0806502338 | A -> DEL | LOC_Os08g11050.1 | N | frameshift_variant | Average:46.732; most accessible tissue: Minghui63 flag leaf, score: 88.574 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806502338 | 1.65E-07 | NA | mr1071_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806502338 | 1.99E-07 | NA | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806502338 | 1.76E-06 | NA | mr1100_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806502338 | 2.62E-08 | 1.25E-08 | mr1203_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806502338 | 3.99E-06 | NA | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0806502338 | 6.87E-07 | 5.56E-07 | mr1619_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |