Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806423507:

Variant ID: vg0806423507 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 6423507
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTTGGGGGGAGAGACATCTCTCCCCGCACTGAGGTAACTTGTATCACATTGCATATTTCCCTTTCCAATTGTATATTTCCCTTTCCAATTGCATATTT[T/G]
CTTTCCAACTACATCTTATAAAATTTGAAAACAACATAAAAATTTGCCAAATAGAAAATACCAAAAAGAATGGATAGGTTTGCGTCATGTTAGGTAAGAC

Reverse complement sequence

GTCTTACCTAACATGACGCAAACCTATCCATTCTTTTTGGTATTTTCTATTTGGCAAATTTTTATGTTGTTTTCAAATTTTATAAGATGTAGTTGGAAAG[A/C]
AAATATGCAATTGGAAAGGGAAATATACAATTGGAAAGGGAAATATGCAATGTGATACAAGTTACCTCAGTGCGGGGAGAGATGTCTCTCCCCCCAAGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.30%	30.30%	1.40%	29.07%	NA
All Indica	2759	39.60%	9.70%	2.32%	48.39%	NA
All Japonica	1512	24.90%	74.20%	0.00%	0.93%	NA
Aus	269	98.90%	0.40%	0.37%	0.37%	NA
Indica I	595	24.50%	24.90%	5.38%	45.21%	NA
Indica II	465	51.00%	6.70%	2.15%	40.22%	NA
Indica III	913	35.60%	1.30%	0.88%	62.21%	NA
Indica Intermediate	786	48.90%	9.80%	1.78%	39.57%	NA
Temperate Japonica	767	43.00%	55.90%	0.00%	1.04%	NA
Tropical Japonica	504	2.80%	96.40%	0.00%	0.79%	NA
Japonica Intermediate	241	13.30%	85.90%	0.00%	0.83%	NA
VI/Aromatic	96	93.80%	3.10%	0.00%	3.12%	NA
Intermediate	90	35.60%	40.00%	1.11%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0806423507	T -> G	LOC_Os08g10890.1	downstream_gene_variant ; 486.0bp to feature; MODIFIER	silent_mutation	Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg0806423507	T -> G	LOC_Os08g10900.1	downstream_gene_variant ; 4119.0bp to feature; MODIFIER	silent_mutation	Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg0806423507	T -> G	LOC_Os08g10890-LOC_Os08g10900	intergenic_region ; MODIFIER	silent_mutation	Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N
vg0806423507	T -> DEL	N	N	silent_mutation	Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0806423507	NA	1.35E-16	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	4.85E-07	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	1.59E-16	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	1.27E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	2.95E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	5.40E-10	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	1.71E-14	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	4.44E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	6.94E-07	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	1.73E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	7.59E-06	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	7.18E-07	NA	mr1080_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	1.82E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	5.55E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	1.32E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	4.44E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	6.36E-06	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	1.12E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	2.26E-07	mr1821_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507	NA	1.35E-20	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251