\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0806423507:

Variant ID: vg0806423507 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 6423507
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTTGGGGGGAGAGACATCTCTCCCCGCACTGAGGTAACTTGTATCACATTGCATATTTCCCTTTCCAATTGTATATTTCCCTTTCCAATTGCATATTT[T/G]
CTTTCCAACTACATCTTATAAAATTTGAAAACAACATAAAAATTTGCCAAATAGAAAATACCAAAAAGAATGGATAGGTTTGCGTCATGTTAGGTAAGAC

Reverse complement sequence

GTCTTACCTAACATGACGCAAACCTATCCATTCTTTTTGGTATTTTCTATTTGGCAAATTTTTATGTTGTTTTCAAATTTTATAAGATGTAGTTGGAAAG[A/C]
AAATATGCAATTGGAAAGGGAAATATACAATTGGAAAGGGAAATATGCAATGTGATACAAGTTACCTCAGTGCGGGGAGAGATGTCTCTCCCCCCAAGCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.30% 30.30% 1.40% 29.07% NA
All Indica  2759 39.60% 9.70% 2.32% 48.39% NA
All Japonica  1512 24.90% 74.20% 0.00% 0.93% NA
Aus  269 98.90% 0.40% 0.37% 0.37% NA
Indica I  595 24.50% 24.90% 5.38% 45.21% NA
Indica II  465 51.00% 6.70% 2.15% 40.22% NA
Indica III  913 35.60% 1.30% 0.88% 62.21% NA
Indica Intermediate  786 48.90% 9.80% 1.78% 39.57% NA
Temperate Japonica  767 43.00% 55.90% 0.00% 1.04% NA
Tropical Japonica  504 2.80% 96.40% 0.00% 0.79% NA
Japonica Intermediate  241 13.30% 85.90% 0.00% 0.83% NA
VI/Aromatic  96 93.80% 3.10% 0.00% 3.12% NA
Intermediate  90 35.60% 40.00% 1.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0806423507 T -> G LOC_Os08g10890.1 downstream_gene_variant ; 486.0bp to feature; MODIFIER silent_mutation Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg0806423507 T -> G LOC_Os08g10900.1 downstream_gene_variant ; 4119.0bp to feature; MODIFIER silent_mutation Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg0806423507 T -> G LOC_Os08g10890-LOC_Os08g10900 intergenic_region ; MODIFIER silent_mutation Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N
vg0806423507 T -> DEL N N silent_mutation Average:25.029; most accessible tissue: Minghui63 young leaf, score: 51.901 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0806423507 NA 1.35E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 4.85E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 1.59E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 1.27E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 2.95E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 5.40E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 1.71E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 4.44E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 6.94E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 1.73E-06 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 7.59E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 7.18E-07 NA mr1080_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 1.82E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 5.55E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 1.32E-07 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 4.44E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 6.36E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 1.12E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 2.26E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0806423507 NA 1.35E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251