\
| Variant ID: vg0806410047 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 6410047 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTAAACAAAGGTTAGAGAAGGGTTTTTGTTTGTTGTGGCTCGGTTTGGTAGTTCTCCTCCGTTGGCAGATTTGCATTGTTTCGGTTTTTTTGTTGTTTC[G/A,T]
GGGGTCTAAATGATGTTTTCTACGAAAGTGTATAACTAGGAAGTTGTAGAAAATTCATAGACCTATCTTCTGACCAGAGGGCGCAATTTTATCTTTAGTT
AACTAAAGATAAAATTGCGCCCTCTGGTCAGAAGATAGGTCTATGAATTTTCTACAACTTCCTAGTTATACACTTTCGTAGAAAACATCATTTAGACCCC[C/T,A]
GAAACAACAAAAAAACCGAAACAATGCAAATCTGCCAACGGAGGAGAACTACCAAACCGAGCCACAACAAACAAAAACCCTTCTCTAACCTTTGTTTACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 24.50% | 5.67% | 4.19% | T: 0.06% |
| All Indica | 2759 | 45.10% | 40.80% | 8.37% | 5.65% | T: 0.11% |
| All Japonica | 1512 | 97.80% | 0.70% | 0.46% | 0.99% | NA |
| Aus | 269 | 82.90% | 0.40% | 8.92% | 7.81% | NA |
| Indica I | 595 | 48.90% | 43.40% | 6.89% | 0.84% | NA |
| Indica II | 465 | 47.10% | 37.00% | 3.87% | 12.04% | NA |
| Indica III | 913 | 32.50% | 51.00% | 11.17% | 5.15% | T: 0.11% |
| Indica Intermediate | 786 | 55.60% | 29.10% | 8.91% | 6.11% | T: 0.25% |
| Temperate Japonica | 767 | 98.70% | 0.80% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 0.80% | 0.40% | 2.78% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.40% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 2.08% | 2.08% | NA |
| Intermediate | 90 | 66.70% | 24.40% | 4.44% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0806410047 | G -> T | LOC_Os08g10880.1 | downstream_gene_variant ; 1828.0bp to feature; MODIFIER | silent_mutation | Average:41.757; most accessible tissue: Callus, score: 65.394 | N | N | N | N |
| vg0806410047 | G -> T | LOC_Os08g10870-LOC_Os08g10880 | intergenic_region ; MODIFIER | silent_mutation | Average:41.757; most accessible tissue: Callus, score: 65.394 | N | N | N | N |
| vg0806410047 | G -> A | LOC_Os08g10880.1 | downstream_gene_variant ; 1828.0bp to feature; MODIFIER | silent_mutation | Average:41.757; most accessible tissue: Callus, score: 65.394 | N | N | N | N |
| vg0806410047 | G -> A | LOC_Os08g10870-LOC_Os08g10880 | intergenic_region ; MODIFIER | silent_mutation | Average:41.757; most accessible tissue: Callus, score: 65.394 | N | N | N | N |
| vg0806410047 | G -> DEL | N | N | silent_mutation | Average:41.757; most accessible tissue: Callus, score: 65.394 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0806410047 | 2.72E-06 | NA | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |