\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805916803:

Variant ID: vg0805916803 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5916803
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCCGACTCCTACCGATTTGCTATAAGAAAGGGAAAAAAAAGTCCGACTCTAGATCAAATCAACCTTAAAAACGAAAAATAAAATTGTTATGCCAGATT[G/A]
AAGATCTGTTTGCAAAAACGAAACCTACCGGTCGAGAGCATTCTATTTTTATATGATTTTAATTTTTGGATCTATACTTTTGCATTTGAGTCCATGTAAT

Reverse complement sequence

ATTACATGGACTCAAATGCAAAAGTATAGATCCAAAAATTAAAATCATATAAAAATAGAATGCTCTCGACCGGTAGGTTTCGTTTTTGCAAACAGATCTT[C/T]
AATCTGGCATAACAATTTTATTTTTCGTTTTTAAGGTTGATTTGATCTAGAGTCGGACTTTTTTTTCCCTTTCTTATAGCAAATCGGTAGGAGTCGGACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 3.70% 6.07% 22.43% NA
All Indica  2759 54.30% 6.20% 9.86% 29.65% NA
All Japonica  1512 95.10% 0.10% 0.20% 4.56% NA
Aus  269 48.30% 0.00% 3.35% 48.33% NA
Indica I  595 31.30% 0.00% 17.31% 51.43% NA
Indica II  465 43.70% 29.90% 7.10% 19.35% NA
Indica III  913 77.90% 0.00% 7.45% 14.68% NA
Indica Intermediate  786 50.80% 3.90% 8.65% 36.64% NA
Temperate Japonica  767 97.90% 0.10% 0.26% 1.69% NA
Tropical Japonica  504 93.50% 0.00% 0.20% 6.35% NA
Japonica Intermediate  241 89.60% 0.40% 0.00% 9.96% NA
VI/Aromatic  96 74.00% 0.00% 2.08% 23.96% NA
Intermediate  90 74.40% 2.20% 1.11% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805916803 G -> A LOC_Os08g10190.1 upstream_gene_variant ; 4224.0bp to feature; MODIFIER silent_mutation Average:17.703; most accessible tissue: Callus, score: 39.842 N N N N
vg0805916803 G -> A LOC_Os08g10200.1 upstream_gene_variant ; 2776.0bp to feature; MODIFIER silent_mutation Average:17.703; most accessible tissue: Callus, score: 39.842 N N N N
vg0805916803 G -> A LOC_Os08g10210.1 downstream_gene_variant ; 4975.0bp to feature; MODIFIER silent_mutation Average:17.703; most accessible tissue: Callus, score: 39.842 N N N N
vg0805916803 G -> A LOC_Os08g10200-LOC_Os08g10210 intergenic_region ; MODIFIER silent_mutation Average:17.703; most accessible tissue: Callus, score: 39.842 N N N N
vg0805916803 G -> DEL N N silent_mutation Average:17.703; most accessible tissue: Callus, score: 39.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805916803 NA 2.68E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916803 NA 3.11E-06 mr1085 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916803 NA 2.45E-08 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916803 NA 7.90E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251