\
| Variant ID: vg0805916803 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5916803 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTCCGACTCCTACCGATTTGCTATAAGAAAGGGAAAAAAAAGTCCGACTCTAGATCAAATCAACCTTAAAAACGAAAAATAAAATTGTTATGCCAGATT[G/A]
AAGATCTGTTTGCAAAAACGAAACCTACCGGTCGAGAGCATTCTATTTTTATATGATTTTAATTTTTGGATCTATACTTTTGCATTTGAGTCCATGTAAT
ATTACATGGACTCAAATGCAAAAGTATAGATCCAAAAATTAAAATCATATAAAAATAGAATGCTCTCGACCGGTAGGTTTCGTTTTTGCAAACAGATCTT[C/T]
AATCTGGCATAACAATTTTATTTTTCGTTTTTAAGGTTGATTTGATCTAGAGTCGGACTTTTTTTTCCCTTTCTTATAGCAAATCGGTAGGAGTCGGACT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 3.70% | 6.07% | 22.43% | NA |
| All Indica | 2759 | 54.30% | 6.20% | 9.86% | 29.65% | NA |
| All Japonica | 1512 | 95.10% | 0.10% | 0.20% | 4.56% | NA |
| Aus | 269 | 48.30% | 0.00% | 3.35% | 48.33% | NA |
| Indica I | 595 | 31.30% | 0.00% | 17.31% | 51.43% | NA |
| Indica II | 465 | 43.70% | 29.90% | 7.10% | 19.35% | NA |
| Indica III | 913 | 77.90% | 0.00% | 7.45% | 14.68% | NA |
| Indica Intermediate | 786 | 50.80% | 3.90% | 8.65% | 36.64% | NA |
| Temperate Japonica | 767 | 97.90% | 0.10% | 0.26% | 1.69% | NA |
| Tropical Japonica | 504 | 93.50% | 0.00% | 0.20% | 6.35% | NA |
| Japonica Intermediate | 241 | 89.60% | 0.40% | 0.00% | 9.96% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 2.08% | 23.96% | NA |
| Intermediate | 90 | 74.40% | 2.20% | 1.11% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805916803 | G -> A | LOC_Os08g10190.1 | upstream_gene_variant ; 4224.0bp to feature; MODIFIER | silent_mutation | Average:17.703; most accessible tissue: Callus, score: 39.842 | N | N | N | N |
| vg0805916803 | G -> A | LOC_Os08g10200.1 | upstream_gene_variant ; 2776.0bp to feature; MODIFIER | silent_mutation | Average:17.703; most accessible tissue: Callus, score: 39.842 | N | N | N | N |
| vg0805916803 | G -> A | LOC_Os08g10210.1 | downstream_gene_variant ; 4975.0bp to feature; MODIFIER | silent_mutation | Average:17.703; most accessible tissue: Callus, score: 39.842 | N | N | N | N |
| vg0805916803 | G -> A | LOC_Os08g10200-LOC_Os08g10210 | intergenic_region ; MODIFIER | silent_mutation | Average:17.703; most accessible tissue: Callus, score: 39.842 | N | N | N | N |
| vg0805916803 | G -> DEL | N | N | silent_mutation | Average:17.703; most accessible tissue: Callus, score: 39.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805916803 | NA | 2.68E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805916803 | NA | 3.11E-06 | mr1085 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805916803 | NA | 2.45E-08 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805916803 | NA | 7.90E-08 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |