Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0805916766:

Variant ID: vg0805916766 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5916766
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

TCCGTCAAAAAATATAGCGAAAAAAAATTTAAAAAAAAGTCCGACTCCTACCGATTTGCTATAAGAAAGGGAAAAAAAAGTCCGACTCTAGATCAAATCA[A/C]
CCTTAAAAACGAAAAATAAAATTGTTATGCCAGATTGAAGATCTGTTTGCAAAAACGAAACCTACCGGTCGAGAGCATTCTATTTTTATATGATTTTAAT

Reverse complement sequence

ATTAAAATCATATAAAAATAGAATGCTCTCGACCGGTAGGTTTCGTTTTTGCAAACAGATCTTCAATCTGGCATAACAATTTTATTTTTCGTTTTTAAGG[T/G]
TGATTTGATCTAGAGTCGGACTTTTTTTTCCCTTTCTTATAGCAAATCGGTAGGAGTCGGACTTTTTTTTAAATTTTTTTTCGCTATATTTTTTGACGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.70%	5.00%	0.68%	61.64%	NA
All Indica	2759	2.60%	7.40%	0.80%	89.20%	NA
All Japonica	1512	93.90%	0.50%	0.20%	5.36%	NA
Aus	269	1.90%	6.30%	0.74%	91.08%	NA
Indica I	595	2.70%	0.00%	0.34%	96.97%	NA
Indica II	465	4.50%	34.00%	0.86%	60.65%	NA
Indica III	913	1.10%	0.90%	1.20%	96.82%	NA
Indica Intermediate	786	3.20%	4.80%	0.64%	91.35%	NA
Temperate Japonica	767	97.40%	0.40%	0.00%	2.22%	NA
Tropical Japonica	504	92.70%	0.20%	0.40%	6.75%	NA
Japonica Intermediate	241	85.50%	1.70%	0.41%	12.45%	NA
VI/Aromatic	96	7.30%	2.10%	5.21%	85.42%	NA
Intermediate	90	47.80%	3.30%	0.00%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805916766	A -> C	LOC_Os08g10190.1	upstream_gene_variant ; 4187.0bp to feature; MODIFIER	silent_mutation	Average:17.406; most accessible tissue: Callus, score: 39.842	N	N	N	N
vg0805916766	A -> C	LOC_Os08g10200.1	upstream_gene_variant ; 2739.0bp to feature; MODIFIER	silent_mutation	Average:17.406; most accessible tissue: Callus, score: 39.842	N	N	N	N
vg0805916766	A -> C	LOC_Os08g10200-LOC_Os08g10210	intergenic_region ; MODIFIER	silent_mutation	Average:17.406; most accessible tissue: Callus, score: 39.842	N	N	N	N
vg0805916766	A -> DEL	N	N	silent_mutation	Average:17.406; most accessible tissue: Callus, score: 39.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805916766	NA	7.95E-23	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	NA	2.16E-15	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	4.33E-07	3.95E-08	mr1415	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	NA	7.79E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	4.33E-07	3.95E-08	mr1567	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	NA	2.63E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	NA	2.50E-22	mr1839	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	NA	1.08E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	NA	6.40E-12	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766	NA	1.25E-06	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251