\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805916766:

Variant ID: vg0805916766 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5916766
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, A: 0.08, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TCCGTCAAAAAATATAGCGAAAAAAAATTTAAAAAAAAGTCCGACTCCTACCGATTTGCTATAAGAAAGGGAAAAAAAAGTCCGACTCTAGATCAAATCA[A/C]
CCTTAAAAACGAAAAATAAAATTGTTATGCCAGATTGAAGATCTGTTTGCAAAAACGAAACCTACCGGTCGAGAGCATTCTATTTTTATATGATTTTAAT

Reverse complement sequence

ATTAAAATCATATAAAAATAGAATGCTCTCGACCGGTAGGTTTCGTTTTTGCAAACAGATCTTCAATCTGGCATAACAATTTTATTTTTCGTTTTTAAGG[T/G]
TGATTTGATCTAGAGTCGGACTTTTTTTTCCCTTTCTTATAGCAAATCGGTAGGAGTCGGACTTTTTTTTAAATTTTTTTTCGCTATATTTTTTGACGGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.70% 5.00% 0.68% 61.64% NA
All Indica  2759 2.60% 7.40% 0.80% 89.20% NA
All Japonica  1512 93.90% 0.50% 0.20% 5.36% NA
Aus  269 1.90% 6.30% 0.74% 91.08% NA
Indica I  595 2.70% 0.00% 0.34% 96.97% NA
Indica II  465 4.50% 34.00% 0.86% 60.65% NA
Indica III  913 1.10% 0.90% 1.20% 96.82% NA
Indica Intermediate  786 3.20% 4.80% 0.64% 91.35% NA
Temperate Japonica  767 97.40% 0.40% 0.00% 2.22% NA
Tropical Japonica  504 92.70% 0.20% 0.40% 6.75% NA
Japonica Intermediate  241 85.50% 1.70% 0.41% 12.45% NA
VI/Aromatic  96 7.30% 2.10% 5.21% 85.42% NA
Intermediate  90 47.80% 3.30% 0.00% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805916766 A -> C LOC_Os08g10190.1 upstream_gene_variant ; 4187.0bp to feature; MODIFIER silent_mutation Average:17.406; most accessible tissue: Callus, score: 39.842 N N N N
vg0805916766 A -> C LOC_Os08g10200.1 upstream_gene_variant ; 2739.0bp to feature; MODIFIER silent_mutation Average:17.406; most accessible tissue: Callus, score: 39.842 N N N N
vg0805916766 A -> C LOC_Os08g10200-LOC_Os08g10210 intergenic_region ; MODIFIER silent_mutation Average:17.406; most accessible tissue: Callus, score: 39.842 N N N N
vg0805916766 A -> DEL N N silent_mutation Average:17.406; most accessible tissue: Callus, score: 39.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805916766 NA 7.95E-23 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 NA 2.16E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 4.33E-07 3.95E-08 mr1415 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 NA 7.79E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 4.33E-07 3.95E-08 mr1567 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 NA 2.63E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 NA 2.50E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 NA 1.08E-16 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 NA 6.40E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805916766 NA 1.25E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251