\
| Variant ID: vg0805903403 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5903403 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )
TGACGACGATAGCGTTTGAGAAGATCTTGTACATCCTCTCCTTCATGATCTTAAAGTCCAGGGAATCTAGATCTTCGCGATTTGGATCATGCTTTCCATC[G/A]
AACTCAAAAGCTGTACGGGATCTTTCCTTGATTGGAGCTAGTCAGCTCTTGATGAAGTGCCGAGTGATTTGCACTCCCTGCAAACCTTGCTCCTTGAGCT
AGCTCAAGGAGCAAGGTTTGCAGGGAGTGCAAATCACTCGGCACTTCATCAAGAGCTGACTAGCTCCAATCAAGGAAAGATCCCGTACAGCTTTTGAGTT[C/T]
GATGGAAAGCATGATCCAAATCGCGAAGATCTAGATTCCCTGGACTTTAAGATCATGAAGGAGAGGATGTACAAGATCTTCTCAAACGCTATCGTCGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.20% | 18.20% | 9.42% | 26.15% | NA |
| All Indica | 2759 | 24.30% | 22.70% | 14.17% | 38.89% | NA |
| All Japonica | 1512 | 94.50% | 0.90% | 0.66% | 3.90% | NA |
| Aus | 269 | 11.90% | 53.50% | 11.15% | 23.42% | NA |
| Indica I | 595 | 24.00% | 32.10% | 11.60% | 32.27% | NA |
| Indica II | 465 | 45.60% | 14.40% | 7.31% | 32.69% | NA |
| Indica III | 913 | 11.90% | 21.50% | 19.28% | 47.32% | NA |
| Indica Intermediate | 786 | 26.20% | 21.80% | 14.25% | 37.79% | NA |
| Temperate Japonica | 767 | 97.90% | 0.10% | 0.39% | 1.56% | NA |
| Tropical Japonica | 504 | 92.50% | 0.80% | 0.99% | 5.75% | NA |
| Japonica Intermediate | 241 | 88.00% | 3.70% | 0.83% | 7.47% | NA |
| VI/Aromatic | 96 | 9.40% | 66.70% | 5.21% | 18.75% | NA |
| Intermediate | 90 | 48.90% | 15.60% | 10.00% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805903403 | G -> A | LOC_Os08g10180.1 | synonymous_variant ; p.Phe208Phe; LOW | synonymous_codon | Average:31.323; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| vg0805903403 | G -> A | LOC_Os08g10180.1 | synonymous_variant ; p.Phe208Phe; LOW | nonsynonymous_codon ; F208S | Average:31.323; most accessible tissue: Minghui63 flag leaf, score: 63.692 | possibly damaging |
1.768 |
DELETERIOUS | 0.00 |
| vg0805903403 | G -> DEL | LOC_Os08g10180.1 | N | frameshift_variant | Average:31.323; most accessible tissue: Minghui63 flag leaf, score: 63.692 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805903403 | NA | 4.18E-12 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805903403 | NA | 9.10E-07 | mr1113 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805903403 | NA | 7.49E-15 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805903403 | NA | 3.17E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805903403 | 4.01E-06 | 1.28E-06 | mr1587 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805903403 | NA | 4.13E-10 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805903403 | NA | 6.33E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805903403 | NA | 3.34E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |