\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805902494:

Variant ID: vg0805902494 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5902494
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGTTATTCAGATTGGCATTGCTTGAGAAGATGGGTTACCTGAAGAAGTTTCTGGATGAGCGCGAGGTGATCCTTGCCCTTTATCTGATGATCCAGGTG[T/C]
CGGGTCGTTATCAGCGTCCGGTTCTTGGGAAACATTAGCCTGAGTTTCAACCTCAGGGATTTCCTGGTCTAGCCCCGCTTCCGACTGGTTTCCAGTCGGG

Reverse complement sequence

CCCGACTGGAAACCAGTCGGAAGCGGGGCTAGACCAGGAAATCCCTGAGGTTGAAACTCAGGCTAATGTTTCCCAAGAACCGGACGCTGATAACGACCCG[A/G]
CACCTGGATCATCAGATAAAGGGCAAGGATCACCTCGCGCTCATCCAGAAACTTCTTCAGGTAACCCATCTTCTCAAGCAATGCCAATCTGAATAACTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.20% 5.30% 19.00% 26.47% NA
All Indica  2759 27.20% 8.70% 28.89% 35.23% NA
All Japonica  1512 89.90% 0.30% 1.46% 8.33% NA
Aus  269 56.90% 0.70% 16.36% 26.02% NA
Indica I  595 25.00% 2.20% 12.61% 60.17% NA
Indica II  465 51.00% 4.10% 23.44% 21.51% NA
Indica III  913 15.30% 15.90% 41.95% 26.83% NA
Indica Intermediate  786 28.60% 7.90% 29.26% 34.22% NA
Temperate Japonica  767 98.20% 0.00% 0.39% 1.43% NA
Tropical Japonica  504 78.80% 0.60% 3.37% 17.26% NA
Japonica Intermediate  241 86.70% 0.80% 0.83% 11.62% NA
VI/Aromatic  96 10.40% 3.10% 23.96% 62.50% NA
Intermediate  90 58.90% 2.20% 13.33% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805902494 T -> C LOC_Os08g10180.1 missense_variant ; p.Thr457Ala; MODERATE nonsynonymous_codon ; T457A Average:40.453; most accessible tissue: Minghui63 young leaf, score: 81.195 unknown unknown TOLERATED 0.74
vg0805902494 T -> DEL LOC_Os08g10180.1 N frameshift_variant Average:40.453; most accessible tissue: Minghui63 young leaf, score: 81.195 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805902494 2.66E-06 2.92E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902494 1.49E-06 1.03E-08 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902494 NA 1.55E-08 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902494 2.67E-09 2.67E-09 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902494 NA 4.97E-08 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902494 NA 4.37E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902494 NA 4.19E-08 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805902494 NA 3.57E-07 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251