\
| Variant ID: vg0805873180 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5873180 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 97. )
ACTTTCTTGTTGTTGTGGGATGCATGAGGATTCTTCTTCTGTACCATATTGGCACTAGAACCTCCCTCAACCTTTTTGCCCCGGTTGTCCTTTGCCCTCG[T/C]
CTTCTCTTCAACACCCAAAGAGCCAATGAGATCAGAAACACTGAACTCTTGTCTCTTGTGCTTTAGAGAAGTGGCAAAGTCCGACCAAGAAGGTGGCAAT
ATTGCCACCTTCTTGGTCGGACTTTGCCACTTCTCTAAAGCACAAGAGACAAGAGTTCAGTGTTTCTGATCTCATTGGCTCTTTGGGTGTTGAAGAGAAG[A/G]
CGAGGGCAAAGGACAACCGGGGCAAAAAGGTTGAGGGAGGTTCTAGTGCCAATATGGTACAGAAGAAGAATCCTCATGCATCCCACAACAACAAGAAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.20% | 34.70% | 0.66% | 0.42% | NA |
| All Indica | 2759 | 93.90% | 5.50% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 3.80% | 94.20% | 0.66% | 1.32% | NA |
| Aus | 269 | 91.40% | 7.40% | 1.12% | 0.00% | NA |
| Indica I | 595 | 88.70% | 10.10% | 1.18% | 0.00% | NA |
| Indica II | 465 | 92.90% | 6.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 92.90% | 6.20% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 97.80% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 6.20% | 92.70% | 0.40% | 0.79% | NA |
| Japonica Intermediate | 241 | 5.00% | 86.30% | 3.32% | 5.39% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805873180 | T -> C | LOC_Os08g10120.1 | missense_variant ; p.Thr138Ala; MODERATE | nonsynonymous_codon ; T138A | Average:18.066; most accessible tissue: Minghui63 flag leaf, score: 39.69 | benign |
-1.469 |
TOLERATED | 1.00 |
| vg0805873180 | T -> DEL | LOC_Os08g10120.1 | N | frameshift_variant | Average:18.066; most accessible tissue: Minghui63 flag leaf, score: 39.69 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805873180 | NA | 4.13E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0805873180 | NA | 5.39E-23 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 3.02E-29 | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 2.67E-37 | mr1828 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 1.99E-35 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 2.94E-75 | mr1934 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 2.98E-51 | mr1935 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 8.62E-09 | mr1050_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 1.74E-53 | mr1141_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 7.58E-35 | mr1223_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 3.63E-24 | mr1350_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 4.68E-61 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 1.12E-33 | mr1448_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 2.01E-27 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 6.02E-48 | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 1.46E-74 | mr1828_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805873180 | NA | 1.90E-82 | mr1934_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |