\
| Variant ID: vg0805695351 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5695351 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTAGGATGCATCTTTATTAGTCTATTAAGGCATTAATGTGTTCTGTTTTTTAAGTTCGCTATTAAAATTAATAAAAGAACATATTCCTTTATTACCATG[G/T]
AGATGATAAAATATGTTTTAGTTGTCATATCACTGAAAAAGTGGCATTTCAAATTGCAGGTTTATATACTAATAGAACGGTGATTCCAAACAATGCTTGC
GCAAGCATTGTTTGGAATCACCGTTCTATTAGTATATAAACCTGCAATTTGAAATGCCACTTTTTCAGTGATATGACAACTAAAACATATTTTATCATCT[C/A]
CATGGTAATAAAGGAATATGTTCTTTTATTAATTTTAATAGCGAACTTAAAAAACAGAACACATTAATGCCTTAATAGACTAATAAAGATGCATCCTAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 9.60% | 2.90% | 21.22% | NA |
| All Indica | 2759 | 51.30% | 14.60% | 4.28% | 29.79% | NA |
| All Japonica | 1512 | 99.40% | 0.10% | 0.33% | 0.13% | NA |
| Aus | 269 | 23.80% | 18.20% | 3.35% | 54.65% | NA |
| Indica I | 595 | 55.00% | 7.60% | 5.04% | 32.44% | NA |
| Indica II | 465 | 66.70% | 3.20% | 6.02% | 24.09% | NA |
| Indica III | 913 | 37.10% | 24.10% | 3.07% | 35.71% | NA |
| Indica Intermediate | 786 | 55.90% | 15.80% | 4.07% | 24.30% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.40% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 1.04% | 23.96% | NA |
| Intermediate | 90 | 84.40% | 1.10% | 4.44% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805695351 | G -> T | LOC_Os08g09870.1 | downstream_gene_variant ; 1305.0bp to feature; MODIFIER | silent_mutation | Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 | N | N | N | N |
| vg0805695351 | G -> T | LOC_Os08g09880.1 | downstream_gene_variant ; 4908.0bp to feature; MODIFIER | silent_mutation | Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 | N | N | N | N |
| vg0805695351 | G -> T | LOC_Os08g09860.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 | N | N | N | N |
| vg0805695351 | G -> DEL | N | N | silent_mutation | Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805695351 | NA | 3.20E-07 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | NA | 2.01E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | NA | 1.12E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | NA | 6.18E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | 9.17E-07 | NA | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | 4.14E-06 | 6.33E-06 | mr1807 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | 7.23E-06 | 7.18E-06 | mr1954 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | NA | 2.13E-06 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | NA | 2.18E-06 | mr1553_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805695351 | NA | 3.13E-06 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |