\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805695351:

Variant ID: vg0805695351 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5695351
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAGGATGCATCTTTATTAGTCTATTAAGGCATTAATGTGTTCTGTTTTTTAAGTTCGCTATTAAAATTAATAAAAGAACATATTCCTTTATTACCATG[G/T]
AGATGATAAAATATGTTTTAGTTGTCATATCACTGAAAAAGTGGCATTTCAAATTGCAGGTTTATATACTAATAGAACGGTGATTCCAAACAATGCTTGC

Reverse complement sequence

GCAAGCATTGTTTGGAATCACCGTTCTATTAGTATATAAACCTGCAATTTGAAATGCCACTTTTTCAGTGATATGACAACTAAAACATATTTTATCATCT[C/A]
CATGGTAATAAAGGAATATGTTCTTTTATTAATTTTAATAGCGAACTTAAAAAACAGAACACATTAATGCCTTAATAGACTAATAAAGATGCATCCTAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.20% 9.60% 2.90% 21.22% NA
All Indica  2759 51.30% 14.60% 4.28% 29.79% NA
All Japonica  1512 99.40% 0.10% 0.33% 0.13% NA
Aus  269 23.80% 18.20% 3.35% 54.65% NA
Indica I  595 55.00% 7.60% 5.04% 32.44% NA
Indica II  465 66.70% 3.20% 6.02% 24.09% NA
Indica III  913 37.10% 24.10% 3.07% 35.71% NA
Indica Intermediate  786 55.90% 15.80% 4.07% 24.30% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 98.30% 0.40% 1.24% 0.00% NA
VI/Aromatic  96 75.00% 0.00% 1.04% 23.96% NA
Intermediate  90 84.40% 1.10% 4.44% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805695351 G -> T LOC_Os08g09870.1 downstream_gene_variant ; 1305.0bp to feature; MODIFIER silent_mutation Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0805695351 G -> T LOC_Os08g09880.1 downstream_gene_variant ; 4908.0bp to feature; MODIFIER silent_mutation Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0805695351 G -> T LOC_Os08g09860.1 intron_variant ; MODIFIER silent_mutation Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N
vg0805695351 G -> DEL N N silent_mutation Average:43.547; most accessible tissue: Minghui63 flag leaf, score: 84.227 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805695351 NA 3.20E-07 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 NA 2.01E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 NA 1.12E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 NA 6.18E-07 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 9.17E-07 NA mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 4.14E-06 6.33E-06 mr1807 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 7.23E-06 7.18E-06 mr1954 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 NA 2.13E-06 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 NA 2.18E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805695351 NA 3.13E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251