\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805580340:

Variant ID: vg0805580340 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5580340
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.03, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


GCGAAGGTTAGCTAAGGGCAAGCTCAGTATATCCTACCCAACTCGGTAGGAGGGTGGACCCAAACAGTACATAGCAATAGTATATCACAGGAAGCCACAA[A/T]
GCTTATGTGCAATAGGGAGGAATAAGGTGGACCCCTCTTGAAAAAGGCAAATTTTGCTACAGGACACTTGTTATGTGTGCTTTTAGCCCAAGGACACTGC

Reverse complement sequence

GCAGTGTCCTTGGGCTAAAAGCACACATAACAAGTGTCCTGTAGCAAAATTTGCCTTTTTCAAGAGGGGTCCACCTTATTCCTCCCTATTGCACATAAGC[T/A]
TTGTGGCTTCCTGTGATATACTATTGCTATGTACTGTTTGGGTCCACCCTCCTACCGAGTTGGGTAGGATATACTGAGCTTGCCCTTAGCTAACCTTCGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.10% 36.30% 0.99% 24.61% NA
All Indica  2759 17.10% 51.00% 1.09% 30.84% NA
All Japonica  1512 85.60% 1.20% 0.66% 12.50% NA
Aus  269 0.40% 82.90% 0.74% 15.99% NA
Indica I  595 40.50% 17.80% 1.01% 40.67% NA
Indica II  465 11.40% 44.30% 0.65% 43.66% NA
Indica III  913 6.20% 78.00% 0.77% 15.01% NA
Indica Intermediate  786 15.40% 48.60% 1.78% 34.22% NA
Temperate Japonica  767 96.00% 0.40% 0.26% 3.39% NA
Tropical Japonica  504 74.20% 1.60% 1.19% 23.02% NA
Japonica Intermediate  241 76.80% 2.90% 0.83% 19.50% NA
VI/Aromatic  96 3.10% 37.50% 2.08% 57.29% NA
Intermediate  90 32.20% 36.70% 3.33% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805580340 A -> T LOC_Os08g09650.1 upstream_gene_variant ; 1685.0bp to feature; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0805580340 A -> T LOC_Os08g09660.1 upstream_gene_variant ; 237.0bp to feature; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0805580340 A -> T LOC_Os08g09670.1 downstream_gene_variant ; 3888.0bp to feature; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0805580340 A -> T LOC_Os08g09650-LOC_Os08g09660 intergenic_region ; MODIFIER silent_mutation Average:62.74; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0805580340 A -> DEL N N silent_mutation Average:62.74; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805580340 NA 8.80E-07 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 4.41E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 2.21E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 9.47E-13 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 9.63E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 9.67E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 2.48E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 2.75E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 4.53E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 6.54E-08 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 6.85E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 5.86E-06 mr1304_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 9.23E-06 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 1.42E-08 mr1359_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 7.81E-07 6.16E-07 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 6.81E-06 6.81E-06 mr1456_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 7.44E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 1.32E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 5.33E-07 mr1511_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 3.50E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 7.89E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 6.44E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 6.52E-08 mr1729_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 3.89E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 7.34E-06 mr1784_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 3.24E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 4.45E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805580340 NA 2.76E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251