\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805574630:

Variant ID: vg0805574630 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5574630
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, T: 0.21, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGTCCACAAAGTCCTACACTACACCCTCTAGCCTCCGCCCCAGAATAAGTTTATTTATGGGTTATTATATCTAACATTTGACCGTCTGTTTTACTTAA[A/T]
TTTTTTTATTATTAATATTTTTATTGTGAAATGGTAAAACATGAATAATATTTTGTGTGTGACTTAAGTTTTTAAAATAGAATGGACGATCAAGCGTCGG

Reverse complement sequence

CCGACGCTTGATCGTCCATTCTATTTTAAAAACTTAAGTCACACACAAAATATTATTCATGTTTTACCATTTCACAATAAAAATATTAATAATAAAAAAA[T/A]
TTAAGTAAAACAGACGGTCAAATGTTAGATATAATAACCCATAAATAAACTTATTCTGGGGCGGAGGCTAGAGGGTGTAGTGTAGGACTTTGTGGACTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 34.00% 1.93% 21.98% NA
All Indica  2759 23.40% 45.70% 1.34% 29.54% NA
All Japonica  1512 86.20% 1.10% 1.39% 11.38% NA
Aus  269 1.10% 98.10% 0.00% 0.74% NA
Indica I  595 40.20% 19.00% 1.01% 39.83% NA
Indica II  465 39.60% 15.50% 1.94% 43.01% NA
Indica III  913 8.20% 77.70% 0.88% 13.25% NA
Indica Intermediate  786 18.70% 46.80% 1.78% 32.70% NA
Temperate Japonica  767 96.50% 0.40% 0.00% 3.13% NA
Tropical Japonica  504 74.40% 1.60% 2.98% 21.03% NA
Japonica Intermediate  241 78.00% 2.10% 2.49% 17.43% NA
VI/Aromatic  96 4.20% 35.40% 28.12% 32.29% NA
Intermediate  90 40.00% 32.20% 6.67% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805574630 A -> T LOC_Os08g09640.1 upstream_gene_variant ; 246.0bp to feature; MODIFIER silent_mutation Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805574630 A -> T LOC_Os08g09630.1 downstream_gene_variant ; 3296.0bp to feature; MODIFIER silent_mutation Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805574630 A -> T LOC_Os08g09650.1 downstream_gene_variant ; 1837.0bp to feature; MODIFIER silent_mutation Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805574630 A -> T LOC_Os08g09640-LOC_Os08g09650 intergenic_region ; MODIFIER silent_mutation Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N
vg0805574630 A -> DEL N N silent_mutation Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805574630 NA 2.15E-09 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 3.02E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 9.64E-07 mr1177 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.82E-07 mr1177 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 9.55E-07 mr1179 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 2.92E-11 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.34E-07 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.48E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.78E-07 mr1221 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.19E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.95E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 4.28E-08 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 3.64E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 5.24E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 3.97E-08 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.21E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 2.40E-06 mr1602 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 3.43E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 2.96E-09 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.99E-08 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 3.92E-06 mr1807 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 2.20E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.04E-13 mr1063_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 9.78E-11 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 4.17E-10 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 8.82E-09 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.14E-11 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 2.58E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.63E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 7.78E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 5.84E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.43E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 4.91E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 2.71E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 1.44E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 2.37E-09 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630 NA 6.76E-11 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251