Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805574630:

Variant ID: vg0805574630 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5574630
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, T: 0.21, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

AAAGTCCACAAAGTCCTACACTACACCCTCTAGCCTCCGCCCCAGAATAAGTTTATTTATGGGTTATTATATCTAACATTTGACCGTCTGTTTTACTTAA[A/T]
TTTTTTTATTATTAATATTTTTATTGTGAAATGGTAAAACATGAATAATATTTTGTGTGTGACTTAAGTTTTTAAAATAGAATGGACGATCAAGCGTCGG

Reverse complement sequence

CCGACGCTTGATCGTCCATTCTATTTTAAAAACTTAAGTCACACACAAAATATTATTCATGTTTTACCATTTCACAATAAAAATATTAATAATAAAAAAA[T/A]
TTAAGTAAAACAGACGGTCAAATGTTAGATATAATAACCCATAAATAAACTTATTCTGGGGCGGAGGCTAGAGGGTGTAGTGTAGGACTTTGTGGACTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.10%	34.00%	1.93%	21.98%	NA
All Indica	2759	23.40%	45.70%	1.34%	29.54%	NA
All Japonica	1512	86.20%	1.10%	1.39%	11.38%	NA
Aus	269	1.10%	98.10%	0.00%	0.74%	NA
Indica I	595	40.20%	19.00%	1.01%	39.83%	NA
Indica II	465	39.60%	15.50%	1.94%	43.01%	NA
Indica III	913	8.20%	77.70%	0.88%	13.25%	NA
Indica Intermediate	786	18.70%	46.80%	1.78%	32.70%	NA
Temperate Japonica	767	96.50%	0.40%	0.00%	3.13%	NA
Tropical Japonica	504	74.40%	1.60%	2.98%	21.03%	NA
Japonica Intermediate	241	78.00%	2.10%	2.49%	17.43%	NA
VI/Aromatic	96	4.20%	35.40%	28.12%	32.29%	NA
Intermediate	90	40.00%	32.20%	6.67%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805574630	A -> T	LOC_Os08g09640.1	upstream_gene_variant ; 246.0bp to feature; MODIFIER	silent_mutation	Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0805574630	A -> T	LOC_Os08g09630.1	downstream_gene_variant ; 3296.0bp to feature; MODIFIER	silent_mutation	Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0805574630	A -> T	LOC_Os08g09650.1	downstream_gene_variant ; 1837.0bp to feature; MODIFIER	silent_mutation	Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0805574630	A -> T	LOC_Os08g09640-LOC_Os08g09650	intergenic_region ; MODIFIER	silent_mutation	Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N
vg0805574630	A -> DEL	N	N	silent_mutation	Average:68.639; most accessible tissue: Zhenshan97 panicle, score: 79.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805574630	NA	2.15E-09	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	3.02E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	9.64E-07	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.82E-07	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	9.55E-07	mr1179	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	2.92E-11	mr1180	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.34E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.48E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.78E-07	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.19E-06	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.95E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	4.28E-08	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	3.64E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	5.24E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	3.97E-08	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.21E-06	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	2.40E-06	mr1602	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	3.43E-06	mr1624	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	2.96E-09	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.99E-08	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	3.92E-06	mr1807	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	2.20E-07	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.04E-13	mr1063_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	9.78E-11	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	4.17E-10	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	8.82E-09	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.14E-11	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	2.58E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.63E-07	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	7.78E-06	mr1260_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	5.84E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.43E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	4.91E-08	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	2.71E-12	mr1803_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	1.44E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	2.37E-09	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805574630	NA	6.76E-11	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251