\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805528297:

Variant ID: vg0805528297 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5528297
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


ACCCCGGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAAGAAACTATTCTAAAGATAAAAGGAAAACATAAAGTCCTTATC[G/A]
GACACTAAACACACTTTCCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAATAGATAAACTGTCATGCCGCATCCTTCTTGAACTCGGTCTCTT

Reverse complement sequence

AAGAGACCGAGTTCAAGAAGGATGCGGCATGACAGTTTATCTATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTC[C/T]
GATAAGGACTTTATGTTTTCCTTTTATCTTTAGAATAGTTTCTTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCCGGGGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 7.00% 4.27% 12.87% NA
All Indica  2759 73.10% 6.00% 4.71% 16.20% NA
All Japonica  1512 78.90% 10.10% 3.51% 7.54% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 74.30% 3.70% 7.39% 14.62% NA
Indica II  465 65.20% 4.30% 4.30% 26.24% NA
Indica III  913 80.60% 4.90% 1.31% 13.14% NA
Indica Intermediate  786 68.10% 10.10% 6.87% 15.01% NA
Temperate Japonica  767 97.00% 0.10% 1.17% 1.69% NA
Tropical Japonica  504 51.40% 28.40% 4.76% 15.48% NA
Japonica Intermediate  241 78.80% 3.30% 8.30% 9.54% NA
VI/Aromatic  96 49.00% 1.00% 13.54% 36.46% NA
Intermediate  90 66.70% 13.30% 6.67% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805528297 G -> A LOC_Os08g09520.1 upstream_gene_variant ; 4863.0bp to feature; MODIFIER silent_mutation Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0805528297 G -> A LOC_Os08g09540.1 upstream_gene_variant ; 1198.0bp to feature; MODIFIER silent_mutation Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0805528297 G -> A LOC_Os08g09570.1 upstream_gene_variant ; 4056.0bp to feature; MODIFIER silent_mutation Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0805528297 G -> A LOC_Os08g09530.1 downstream_gene_variant ; 2465.0bp to feature; MODIFIER silent_mutation Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0805528297 G -> A LOC_Os08g09540-LOC_Os08g09570 intergenic_region ; MODIFIER silent_mutation Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N
vg0805528297 G -> DEL N N silent_mutation Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805528297 NA 2.04E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.83E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 6.87E-11 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.65E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 2.04E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 2.10E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.86E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 5.31E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 2.01E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.42E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 9.21E-17 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 8.63E-09 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.31E-12 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 2.27E-07 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.74E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 5.36E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.32E-08 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 9.21E-16 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 2.66E-14 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 3.22E-06 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 8.50E-06 1.15E-18 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 1.87E-13 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 5.91E-20 mr1390_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 2.00E-06 7.28E-21 mr1490_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 4.07E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297 NA 3.29E-10 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251