Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805528297:

Variant ID: vg0805528297 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5528297
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

ACCCCGGGTGTACATATTTATACCCATGGGTTGATACAAGTCCTTGTCGGACAAGAAAGAAACTATTCTAAAGATAAAAGGAAAACATAAAGTCCTTATC[G/A]
GACACTAAACACACTTTCCTAAAGATAAAAGGAAACTAACAAACTATTCCTAATTAATAGATAAACTGTCATGCCGCATCCTTCTTGAACTCGGTCTCTT

Reverse complement sequence

AAGAGACCGAGTTCAAGAAGGATGCGGCATGACAGTTTATCTATTAATTAGGAATAGTTTGTTAGTTTCCTTTTATCTTTAGGAAAGTGTGTTTAGTGTC[C/T]
GATAAGGACTTTATGTTTTCCTTTTATCTTTAGAATAGTTTCTTTCTTGTCCGACAAGGACTTGTATCAACCCATGGGTATAAATATGTACACCCGGGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.90%	7.00%	4.27%	12.87%	NA
All Indica	2759	73.10%	6.00%	4.71%	16.20%	NA
All Japonica	1512	78.90%	10.10%	3.51%	7.54%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	74.30%	3.70%	7.39%	14.62%	NA
Indica II	465	65.20%	4.30%	4.30%	26.24%	NA
Indica III	913	80.60%	4.90%	1.31%	13.14%	NA
Indica Intermediate	786	68.10%	10.10%	6.87%	15.01%	NA
Temperate Japonica	767	97.00%	0.10%	1.17%	1.69%	NA
Tropical Japonica	504	51.40%	28.40%	4.76%	15.48%	NA
Japonica Intermediate	241	78.80%	3.30%	8.30%	9.54%	NA
VI/Aromatic	96	49.00%	1.00%	13.54%	36.46%	NA
Intermediate	90	66.70%	13.30%	6.67%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805528297	G -> A	LOC_Os08g09520.1	upstream_gene_variant ; 4863.0bp to feature; MODIFIER	silent_mutation	Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0805528297	G -> A	LOC_Os08g09540.1	upstream_gene_variant ; 1198.0bp to feature; MODIFIER	silent_mutation	Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0805528297	G -> A	LOC_Os08g09570.1	upstream_gene_variant ; 4056.0bp to feature; MODIFIER	silent_mutation	Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0805528297	G -> A	LOC_Os08g09530.1	downstream_gene_variant ; 2465.0bp to feature; MODIFIER	silent_mutation	Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0805528297	G -> A	LOC_Os08g09540-LOC_Os08g09570	intergenic_region ; MODIFIER	silent_mutation	Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N
vg0805528297	G -> DEL	N	N	silent_mutation	Average:35.116; most accessible tissue: Zhenshan97 panicle, score: 46.362	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805528297	NA	2.04E-11	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.83E-12	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	6.87E-11	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.65E-09	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	2.04E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	2.10E-14	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.86E-13	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	5.31E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	2.01E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.42E-13	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	9.21E-17	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	8.63E-09	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.31E-12	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	2.27E-07	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.74E-09	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	5.36E-11	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.32E-08	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	9.21E-16	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	2.66E-14	mr1079_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	3.22E-06	NA	mr1132_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	8.50E-06	1.15E-18	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	1.87E-13	mr1178_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	5.91E-20	mr1390_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	2.00E-06	7.28E-21	mr1490_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	4.07E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805528297	NA	3.29E-10	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251