Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0805348696:

Variant ID: vg0805348696 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5348696
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGAAGAGTAAAACAATATATATTAATATTGATTTTTTTTTTTTGGAAATCCCCCGTTAAGTATATACCCCTTGGGTCTCCCTAAGGCTTAATAAGTATA[G/C]
AAGGGGATTTATATGGATACCCTTATAATATAGATATTTAGAAAGGTAATTATAGACAATTTAACCATGGGTTTCTTTGTAAGTCGCAACATGTGTCTCT

Reverse complement sequence

AGAGACACATGTTGCGACTTACAAAGAAACCCATGGTTAAATTGTCTATAATTACCTTTCTAAATATCTATATTATAAGGGTATCCATATAAATCCCCTT[C/G]
TATACTTATTAAGCCTTAGGGAGACCCAAGGGGTATATACTTAACGGGGGATTTCCAAAAAAAAAAAATCAATATTAATATATATTGTTTTACTCTTCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	39.40%	0.53%	0.13%	NA
All Indica	2759	55.60%	43.60%	0.62%	0.22%	NA
All Japonica	1512	59.50%	40.10%	0.40%	0.00%	NA
Aus	269	97.00%	3.00%	0.00%	0.00%	NA
Indica I	595	49.90%	48.60%	0.67%	0.84%	NA
Indica II	465	47.10%	52.50%	0.43%	0.00%	NA
Indica III	913	68.50%	30.90%	0.66%	0.00%	NA
Indica Intermediate	786	49.90%	49.40%	0.64%	0.13%	NA
Temperate Japonica	767	92.00%	7.80%	0.13%	0.00%	NA
Tropical Japonica	504	9.10%	90.10%	0.79%	0.00%	NA
Japonica Intermediate	241	61.40%	38.20%	0.41%	0.00%	NA
VI/Aromatic	96	94.80%	5.20%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805348696	G -> C	LOC_Os08g09220.1	upstream_gene_variant ; 1475.0bp to feature; MODIFIER	silent_mutation	Average:61.186; most accessible tissue: Callus, score: 77.166	N	N	N	N
vg0805348696	G -> C	LOC_Os08g09230.1	upstream_gene_variant ; 3409.0bp to feature; MODIFIER	silent_mutation	Average:61.186; most accessible tissue: Callus, score: 77.166	N	N	N	N
vg0805348696	G -> C	LOC_Os08g09230.2	upstream_gene_variant ; 3409.0bp to feature; MODIFIER	silent_mutation	Average:61.186; most accessible tissue: Callus, score: 77.166	N	N	N	N
vg0805348696	G -> C	LOC_Os08g09210.1	downstream_gene_variant ; 3275.0bp to feature; MODIFIER	silent_mutation	Average:61.186; most accessible tissue: Callus, score: 77.166	N	N	N	N
vg0805348696	G -> C	LOC_Os08g09210.2	downstream_gene_variant ; 3275.0bp to feature; MODIFIER	silent_mutation	Average:61.186; most accessible tissue: Callus, score: 77.166	N	N	N	N
vg0805348696	G -> C	LOC_Os08g09220-LOC_Os08g09230	intergenic_region ; MODIFIER	silent_mutation	Average:61.186; most accessible tissue: Callus, score: 77.166	N	N	N	N
vg0805348696	G -> DEL	N	N	silent_mutation	Average:61.186; most accessible tissue: Callus, score: 77.166	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805348696	NA	7.14E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696	NA	3.48E-07	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696	NA	7.11E-09	mr1657	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696	NA	1.53E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696	NA	1.21E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251