\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805348696:

Variant ID: vg0805348696 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5348696
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAAGAGTAAAACAATATATATTAATATTGATTTTTTTTTTTTGGAAATCCCCCGTTAAGTATATACCCCTTGGGTCTCCCTAAGGCTTAATAAGTATA[G/C]
AAGGGGATTTATATGGATACCCTTATAATATAGATATTTAGAAAGGTAATTATAGACAATTTAACCATGGGTTTCTTTGTAAGTCGCAACATGTGTCTCT

Reverse complement sequence

AGAGACACATGTTGCGACTTACAAAGAAACCCATGGTTAAATTGTCTATAATTACCTTTCTAAATATCTATATTATAAGGGTATCCATATAAATCCCCTT[C/G]
TATACTTATTAAGCCTTAGGGAGACCCAAGGGGTATATACTTAACGGGGGATTTCCAAAAAAAAAAAATCAATATTAATATATATTGTTTTACTCTTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.40% 0.53% 0.13% NA
All Indica  2759 55.60% 43.60% 0.62% 0.22% NA
All Japonica  1512 59.50% 40.10% 0.40% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 49.90% 48.60% 0.67% 0.84% NA
Indica II  465 47.10% 52.50% 0.43% 0.00% NA
Indica III  913 68.50% 30.90% 0.66% 0.00% NA
Indica Intermediate  786 49.90% 49.40% 0.64% 0.13% NA
Temperate Japonica  767 92.00% 7.80% 0.13% 0.00% NA
Tropical Japonica  504 9.10% 90.10% 0.79% 0.00% NA
Japonica Intermediate  241 61.40% 38.20% 0.41% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805348696 G -> C LOC_Os08g09220.1 upstream_gene_variant ; 1475.0bp to feature; MODIFIER silent_mutation Average:61.186; most accessible tissue: Callus, score: 77.166 N N N N
vg0805348696 G -> C LOC_Os08g09230.1 upstream_gene_variant ; 3409.0bp to feature; MODIFIER silent_mutation Average:61.186; most accessible tissue: Callus, score: 77.166 N N N N
vg0805348696 G -> C LOC_Os08g09230.2 upstream_gene_variant ; 3409.0bp to feature; MODIFIER silent_mutation Average:61.186; most accessible tissue: Callus, score: 77.166 N N N N
vg0805348696 G -> C LOC_Os08g09210.1 downstream_gene_variant ; 3275.0bp to feature; MODIFIER silent_mutation Average:61.186; most accessible tissue: Callus, score: 77.166 N N N N
vg0805348696 G -> C LOC_Os08g09210.2 downstream_gene_variant ; 3275.0bp to feature; MODIFIER silent_mutation Average:61.186; most accessible tissue: Callus, score: 77.166 N N N N
vg0805348696 G -> C LOC_Os08g09220-LOC_Os08g09230 intergenic_region ; MODIFIER silent_mutation Average:61.186; most accessible tissue: Callus, score: 77.166 N N N N
vg0805348696 G -> DEL N N silent_mutation Average:61.186; most accessible tissue: Callus, score: 77.166 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805348696 NA 7.14E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696 NA 3.48E-07 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696 NA 7.11E-09 mr1657 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696 NA 1.53E-07 mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805348696 NA 1.21E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251