\
| Variant ID: vg0805104616 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 5104616 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.18, others allele: 0.00, population size: 97. )
CACAATGTAACTCATTCTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGACATATACATCTATCTAGATTCATTGATATCAATATAAATGTGG[G/A]
AAATGCTAAAATAACTTATATTGTGAAACAGAGTAAGTAGTTAATATGTCCATCCCGTTGCAATGAGATCCCGTCTTGTAGCAGACATGCCGTATAAATC
GATTTATACGGCATGTCTGCTACAAGACGGGATCTCATTGCAACGGGATGGACATATTAACTACTTACTCTGTTTCACAATATAAGTTATTTTAGCATTT[C/T]
CCACATTTATATTGATATCAATGAATCTAGATAGATGTATATGTCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAGAATGAGTTACATTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 86.00% | 13.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.10% | 23.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.60% | 23.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 84.40% | 14.60% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0805104616 | G -> A | LOC_Os08g08820.1 | upstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0805104616 | G -> A | LOC_Os08g08820.2 | upstream_gene_variant ; 4622.0bp to feature; MODIFIER | silent_mutation | Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0805104616 | G -> A | LOC_Os08g08810.1 | downstream_gene_variant ; 2996.0bp to feature; MODIFIER | silent_mutation | Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| vg0805104616 | G -> A | LOC_Os08g08800-LOC_Os08g08810 | intergenic_region ; MODIFIER | silent_mutation | Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0805104616 | NA | 8.62E-11 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104616 | NA | 6.69E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104616 | NA | 5.57E-06 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104616 | NA | 1.09E-17 | mr1410_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104616 | NA | 1.21E-06 | mr1425_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0805104616 | NA | 4.39E-09 | mr1993_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |