\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805104616:

Variant ID: vg0805104616 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5104616
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.18, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CACAATGTAACTCATTCTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGACATATACATCTATCTAGATTCATTGATATCAATATAAATGTGG[G/A]
AAATGCTAAAATAACTTATATTGTGAAACAGAGTAAGTAGTTAATATGTCCATCCCGTTGCAATGAGATCCCGTCTTGTAGCAGACATGCCGTATAAATC

Reverse complement sequence

GATTTATACGGCATGTCTGCTACAAGACGGGATCTCATTGCAACGGGATGGACATATTAACTACTTACTCTGTTTCACAATATAAGTTATTTTAGCATTT[C/T]
CCACATTTATATTGATATCAATGAATCTAGATAGATGTATATGTCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAGAATGAGTTACATTGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.30% 8.60% 0.08% 0.00% NA
All Indica  2759 86.00% 13.90% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 76.10% 23.90% 0.00% 0.00% NA
Indica III  913 76.60% 23.20% 0.22% 0.00% NA
Indica Intermediate  786 92.40% 7.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 84.40% 14.60% 1.04% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805104616 G -> A LOC_Os08g08820.1 upstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg0805104616 G -> A LOC_Os08g08820.2 upstream_gene_variant ; 4622.0bp to feature; MODIFIER silent_mutation Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg0805104616 G -> A LOC_Os08g08810.1 downstream_gene_variant ; 2996.0bp to feature; MODIFIER silent_mutation Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N
vg0805104616 G -> A LOC_Os08g08800-LOC_Os08g08810 intergenic_region ; MODIFIER silent_mutation Average:71.998; most accessible tissue: Minghui63 young leaf, score: 81.5 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805104616 NA 8.62E-11 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104616 NA 6.69E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104616 NA 5.57E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104616 NA 1.09E-17 mr1410_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104616 NA 1.21E-06 mr1425_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805104616 NA 4.39E-09 mr1993_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251