\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805068073:

Variant ID: vg0805068073 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5068073
Reference Allele: CAlternative Allele: T,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCTTATGTTTCCATTTTTTACGTGTTTCGAATTGGAAATTTTGTTTTCTTTCTCAAAGTTAATTTTCTCCGTAGTTTGAATTCGAAATGTCTTACAG[C/T,A]
TGTATTGTTTCGATTAATTAGTTAGTTGCTGATGGTTATAACAAGTCTCATATATGTGAGAAAATGAATATTTAGCCACGTTCAAAAGGCGGTTTCGCTA

Reverse complement sequence

TAGCGAAACCGCCTTTTGAACGTGGCTAAATATTCATTTTCTCACATATATGAGACTTGTTATAACCATCAGCAACTAACTAATTAATCGAAACAATACA[G/A,T]
CTGTAAGACATTTCGAATTCAAACTACGGAGAAAATTAACTTTGAGAAAGAAAACAAAATTTCCAATTCGAAACACGTAAAAAATGGAAACATAAGAACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.80% 19.00% 1.38% 42.62% A: 0.15%
All Indica  2759 57.60% 3.20% 1.81% 37.26% A: 0.22%
All Japonica  1512 1.30% 51.30% 0.46% 47.02% NA
Aus  269 29.00% 7.80% 1.86% 60.97% A: 0.37%
Indica I  595 89.90% 2.00% 0.34% 7.73% NA
Indica II  465 47.70% 6.20% 0.86% 45.16% NA
Indica III  913 44.00% 0.80% 4.16% 50.60% A: 0.44%
Indica Intermediate  786 54.60% 5.00% 0.76% 39.44% A: 0.25%
Temperate Japonica  767 0.70% 86.40% 0.26% 12.65% NA
Tropical Japonica  504 1.60% 4.20% 0.99% 93.25% NA
Japonica Intermediate  241 2.50% 37.80% 0.00% 59.75% NA
VI/Aromatic  96 22.90% 5.20% 1.04% 70.83% NA
Intermediate  90 36.70% 13.30% 2.22% 47.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805068073 C -> T LOC_Os08g08740.1 downstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:58.546; most accessible tissue: Callus, score: 81.456 N N N N
vg0805068073 C -> T LOC_Os08g08730-LOC_Os08g08740 intergenic_region ; MODIFIER silent_mutation Average:58.546; most accessible tissue: Callus, score: 81.456 N N N N
vg0805068073 C -> A LOC_Os08g08740.1 downstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:58.546; most accessible tissue: Callus, score: 81.456 N N N N
vg0805068073 C -> A LOC_Os08g08730-LOC_Os08g08740 intergenic_region ; MODIFIER silent_mutation Average:58.546; most accessible tissue: Callus, score: 81.456 N N N N
vg0805068073 C -> DEL N N silent_mutation Average:58.546; most accessible tissue: Callus, score: 81.456 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805068073 NA 2.64E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 6.74E-06 mr1043_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 8.58E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 8.58E-06 8.58E-06 mr1053_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 2.92E-07 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 1.89E-06 1.89E-06 mr1147_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 2.57E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 5.10E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 4.69E-07 mr1222_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 1.23E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 7.06E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 5.50E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 1.67E-06 1.67E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 4.96E-06 mr1479_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 3.36E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 1.31E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 9.55E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 4.14E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 1.09E-06 1.09E-06 mr1641_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 1.04E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 9.58E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 1.62E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 5.00E-06 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 4.58E-14 mr1800_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 4.72E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 2.12E-06 2.12E-06 mr1824_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 6.08E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 7.50E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 2.14E-08 mr1896_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073 NA 5.42E-06 mr1976_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251