Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0805068073:

Variant ID: vg0805068073 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 5068073
Reference Allele: C	Alternative Allele: T,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.10, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCTTATGTTTCCATTTTTTACGTGTTTCGAATTGGAAATTTTGTTTTCTTTCTCAAAGTTAATTTTCTCCGTAGTTTGAATTCGAAATGTCTTACAG[C/T,A]
TGTATTGTTTCGATTAATTAGTTAGTTGCTGATGGTTATAACAAGTCTCATATATGTGAGAAAATGAATATTTAGCCACGTTCAAAAGGCGGTTTCGCTA

Reverse complement sequence

TAGCGAAACCGCCTTTTGAACGTGGCTAAATATTCATTTTCTCACATATATGAGACTTGTTATAACCATCAGCAACTAACTAATTAATCGAAACAATACA[G/A,T]
CTGTAAGACATTTCGAATTCAAACTACGGAGAAAATTAACTTTGAGAAAGAAAACAAAATTTCCAATTCGAAACACGTAAAAAATGGAAACATAAGAACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.80%	19.00%	1.38%	42.62%	A: 0.15%
All Indica	2759	57.60%	3.20%	1.81%	37.26%	A: 0.22%
All Japonica	1512	1.30%	51.30%	0.46%	47.02%	NA
Aus	269	29.00%	7.80%	1.86%	60.97%	A: 0.37%
Indica I	595	89.90%	2.00%	0.34%	7.73%	NA
Indica II	465	47.70%	6.20%	0.86%	45.16%	NA
Indica III	913	44.00%	0.80%	4.16%	50.60%	A: 0.44%
Indica Intermediate	786	54.60%	5.00%	0.76%	39.44%	A: 0.25%
Temperate Japonica	767	0.70%	86.40%	0.26%	12.65%	NA
Tropical Japonica	504	1.60%	4.20%	0.99%	93.25%	NA
Japonica Intermediate	241	2.50%	37.80%	0.00%	59.75%	NA
VI/Aromatic	96	22.90%	5.20%	1.04%	70.83%	NA
Intermediate	90	36.70%	13.30%	2.22%	47.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0805068073	C -> T	LOC_Os08g08740.1	downstream_gene_variant ; 563.0bp to feature; MODIFIER	silent_mutation	Average:58.546; most accessible tissue: Callus, score: 81.456	N	N	N	N
vg0805068073	C -> T	LOC_Os08g08730-LOC_Os08g08740	intergenic_region ; MODIFIER	silent_mutation	Average:58.546; most accessible tissue: Callus, score: 81.456	N	N	N	N
vg0805068073	C -> A	LOC_Os08g08740.1	downstream_gene_variant ; 563.0bp to feature; MODIFIER	silent_mutation	Average:58.546; most accessible tissue: Callus, score: 81.456	N	N	N	N
vg0805068073	C -> A	LOC_Os08g08730-LOC_Os08g08740	intergenic_region ; MODIFIER	silent_mutation	Average:58.546; most accessible tissue: Callus, score: 81.456	N	N	N	N
vg0805068073	C -> DEL	N	N	silent_mutation	Average:58.546; most accessible tissue: Callus, score: 81.456	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0805068073	NA	2.64E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	6.74E-06	mr1043_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	8.58E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	8.58E-06	8.58E-06	mr1053_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	2.92E-07	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	1.89E-06	1.89E-06	mr1147_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	2.57E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	5.10E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	4.69E-07	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	1.23E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	7.06E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	5.50E-06	mr1252_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	1.67E-06	1.67E-06	mr1440_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	4.96E-06	mr1479_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	3.36E-06	mr1556_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	1.31E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	9.55E-06	mr1596_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	4.14E-06	mr1638_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	1.09E-06	1.09E-06	mr1641_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	1.04E-06	mr1646_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	9.58E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	1.62E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	5.00E-06	mr1764_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	4.58E-14	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	4.72E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	2.12E-06	2.12E-06	mr1824_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	6.08E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	7.50E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	2.14E-08	mr1896_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805068073	NA	5.42E-06	mr1976_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251