\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0805055173:

Variant ID: vg0805055173 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 5055173
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTATAAATAATTTTAGAATGGTGCTTTCGTTCGGTTAATTAAAGAGGTTTGGCGCGCGTCATGAATTATTGATCAGTCTACTGAAATACTCCCTCCGTT[T/C]
CAAAATATTTGACGCCGTTGACTTTTTTAAATATGTTTGACCGTTCGTCTTATTTAAAAAATTTAAGTAATTATTACATCTTTTCCTATCATTTGATTCA

Reverse complement sequence

TGAATCAAATGATAGGAAAAGATGTAATAATTACTTAAATTTTTTAAATAAGACGAACGGTCAAACATATTTAAAAAAGTCAACGGCGTCAAATATTTTG[A/G]
AACGGAGGGAGTATTTCAGTAGACTGATCAATAATTCATGACGCGCGCCAAACCTCTTTAATTAACCGAACGAAAGCACCATTCTAAAATTATTTATAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 3.30% 0.97% 32.25% NA
All Indica  2759 57.50% 0.10% 1.01% 41.36% NA
All Japonica  1512 79.30% 10.10% 0.40% 10.25% NA
Aus  269 45.70% 0.00% 2.97% 51.30% NA
Indica I  595 92.90% 0.00% 0.17% 6.89% NA
Indica II  465 34.20% 0.00% 2.58% 63.23% NA
Indica III  913 44.00% 0.20% 0.99% 54.76% NA
Indica Intermediate  786 60.10% 0.30% 0.76% 38.93% NA
Temperate Japonica  767 90.70% 1.60% 0.39% 7.30% NA
Tropical Japonica  504 69.00% 19.40% 0.40% 11.11% NA
Japonica Intermediate  241 64.30% 17.40% 0.41% 17.84% NA
VI/Aromatic  96 35.40% 0.00% 2.08% 62.50% NA
Intermediate  90 62.20% 2.20% 2.22% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0805055173 T -> C LOC_Os08g08720.1 downstream_gene_variant ; 936.0bp to feature; MODIFIER silent_mutation Average:27.07; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg0805055173 T -> C LOC_Os08g08730.1 downstream_gene_variant ; 3779.0bp to feature; MODIFIER silent_mutation Average:27.07; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg0805055173 T -> C LOC_Os08g08720-LOC_Os08g08730 intergenic_region ; MODIFIER silent_mutation Average:27.07; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N
vg0805055173 T -> DEL N N silent_mutation Average:27.07; most accessible tissue: Zhenshan97 root, score: 86.14 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0805055173 NA 4.96E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 1.52E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 7.56E-06 7.56E-06 mr1286_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 4.16E-06 mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 9.62E-06 9.62E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 2.35E-06 2.35E-06 mr1369_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 5.05E-06 5.04E-06 mr1412_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 7.80E-07 7.80E-07 mr1453_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 3.21E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 5.80E-07 5.80E-07 mr1470_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 8.03E-07 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 1.40E-06 mr1646_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 4.29E-06 4.29E-06 mr1663_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 2.42E-06 1.97E-07 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 7.49E-06 mr1683_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 2.16E-06 2.16E-06 mr1687_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 7.78E-06 mr1689_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 8.49E-06 8.49E-06 mr1700_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 3.95E-07 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 7.23E-07 mr1764_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 2.68E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 NA 4.03E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0805055173 3.19E-06 3.18E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251