Variant ID: vg0805024489 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 5024489 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCAATACATTCAAAATAGTTTACATCGTGTACACAACAATTACGGCAATACATCGGCGGTGACGGTTGACCACACGTACTTTCTCCTCACTATTGTTCC[T/C]
TCCTTGTGATCGCTACGTAAGGGGTGTCTTCATTTGATAGGAGGATGCTAGGGTCAATCGTCACCGTGAAAGGGGGTTGCCCATCAAACTGATCGTAATC
GATTACGATCAGTTTGATGGGCAACCCCCTTTCACGGTGACGATTGACCCTAGCATCCTCCTATCAAATGAAGACACCCCTTACGTAGCGATCACAAGGA[A/G]
GGAACAATAGTGAGGAGAAAGTACGTGTGGTCAACCGTCACCGCCGATGTATTGCCGTAATTGTTGTGTACACGATGTAAACTATTTTGAATGTATTGAA
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 70.60% | 0.30% | 12.21% | 16.93% | NA |
All Indica | 2759 | 66.90% | 0.00% | 13.88% | 19.17% | NA |
All Japonica | 1512 | 75.60% | 0.80% | 8.20% | 15.41% | NA |
Aus | 269 | 80.70% | 0.40% | 15.24% | 3.72% | NA |
Indica I | 595 | 95.10% | 0.00% | 0.84% | 4.03% | NA |
Indica II | 465 | 54.00% | 0.00% | 12.04% | 33.98% | NA |
Indica III | 913 | 52.00% | 0.00% | 23.88% | 24.10% | NA |
Indica Intermediate | 786 | 70.60% | 0.00% | 13.23% | 16.16% | NA |
Temperate Japonica | 767 | 91.00% | 0.10% | 2.09% | 6.78% | NA |
Tropical Japonica | 504 | 50.00% | 2.00% | 17.66% | 30.36% | NA |
Japonica Intermediate | 241 | 80.10% | 0.40% | 7.88% | 11.62% | NA |
VI/Aromatic | 96 | 68.80% | 0.00% | 18.75% | 12.50% | NA |
Intermediate | 90 | 70.00% | 0.00% | 12.22% | 17.78% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0805024489 | T -> C | LOC_Os08g08680.1 | missense_variant ; p.Lys579Arg; MODERATE | nonsynonymous_codon ; K579R | Average:16.58; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 | unknown | unknown | DELETERIOUS | 0.02 |
vg0805024489 | T -> DEL | LOC_Os08g08680.1 | N | frameshift_variant | Average:16.58; most accessible tissue: Zhenshan97 flag leaf, score: 32.264 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0805024489 | NA | 1.34E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | NA | 4.06E-14 | mr1449 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | NA | 2.82E-09 | mr1449 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | NA | 7.22E-07 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | NA | 7.17E-09 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | 1.48E-08 | NA | mr1113_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | 3.66E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | 3.80E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0805024489 | 3.13E-06 | NA | mr1961_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |