| Variant ID: vg0804940220 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 4940220 |
| Reference Allele: GC | Alternative Allele: AC,CC,G |
| Primary Allele: GC | Secondary Allele: AC |
Inferred Ancestral Allele: Not determined.
GTCAAGCCAAATCCAAATCATCCATCCAAGGGTGTGGTAAGTGGTAGCAAAGATCAATATTCTACCTTGTACTAGGTAGTATATATCTAAAGTACGAATT[GC/AC,CC,G]
CCCCCTCCCCCCCCGGAACTATCGCGGTCGTCCGAATTAGCCCCCAGAACAACAAAACCAGGCATTCTTCACCCCCAACTATGAATACCGGACGAATTAC
GTAATTCGTCCGGTATTCATAGTTGGGGGTGAAGAATGCCTGGTTTTGTTGTTCTGGGGGCTAATTCGGACGACCGCGATAGTTCCGGGGGGGGAGGGGG[GC/GT,GG,C]
AATTCGTACTTTAGATATATACTACCTAGTACAAGGTAGAATATTGATCTTTGCTACCACTTACCACACCCTTGGATGGATGATTTGGATTTGGCTTGAC
| Populations | Population Size | Frequency of GC(primary allele) | Frequency of AC(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 13.10% | 30.51% | 16.72% | CC: 2.96%; G: 0.06% |
| All Indica | 2759 | 20.50% | 18.80% | 43.31% | 13.63% | CC: 3.73%; G: 0.04% |
| All Japonica | 1512 | 70.00% | 2.10% | 1.72% | 25.93% | G: 0.13%; CC: 0.07% |
| Aus | 269 | 20.80% | 15.20% | 53.16% | 1.49% | CC: 9.29% |
| Indica I | 595 | 22.40% | 11.10% | 62.52% | 3.70% | G: 0.17%; CC: 0.17% |
| Indica II | 465 | 23.20% | 27.10% | 22.15% | 25.81% | CC: 1.72% |
| Indica III | 913 | 17.40% | 23.20% | 37.90% | 13.69% | CC: 7.78% |
| Indica Intermediate | 786 | 21.10% | 14.50% | 47.58% | 13.87% | CC: 2.93% |
| Temperate Japonica | 767 | 94.80% | 0.10% | 0.39% | 4.69% | NA |
| Tropical Japonica | 504 | 30.00% | 5.60% | 4.17% | 59.92% | G: 0.20%; CC: 0.20% |
| Japonica Intermediate | 241 | 75.10% | 1.20% | 0.83% | 22.41% | G: 0.41% |
| VI/Aromatic | 96 | 18.80% | 15.60% | 55.21% | 3.12% | CC: 7.29% |
| Intermediate | 90 | 34.40% | 16.70% | 27.78% | 16.67% | CC: 4.44% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804940220 | GC -> CC | LOC_Os08g08550.1 | upstream_gene_variant ; 2451.0bp to feature; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> CC | LOC_Os08g08560.1 | downstream_gene_variant ; 322.0bp to feature; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> CC | LOC_Os08g08550-LOC_Os08g08560 | intergenic_region ; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> G | LOC_Os08g08550.1 | upstream_gene_variant ; 2452.0bp to feature; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> G | LOC_Os08g08560.1 | downstream_gene_variant ; 321.0bp to feature; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> G | LOC_Os08g08550-LOC_Os08g08560 | intergenic_region ; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> AC | LOC_Os08g08550.1 | upstream_gene_variant ; 2451.0bp to feature; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> AC | LOC_Os08g08560.1 | downstream_gene_variant ; 322.0bp to feature; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> AC | LOC_Os08g08550-LOC_Os08g08560 | intergenic_region ; MODIFIER | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| vg0804940220 | GC -> DEL | N | N | silent_mutation | Average:51.403; most accessible tissue: Zhenshan97 flag leaf, score: 73.119 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804940220 | NA | 8.61E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804940220 | NA | 9.66E-14 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804940220 | NA | 3.62E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804940220 | 1.80E-06 | 1.80E-06 | mr1420 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804940220 | NA | 3.04E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804940220 | NA | 2.47E-25 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |