\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804605906:

Variant ID: vg0804605906 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 4605906
Reference Allele: TAlternative Allele: TG,TA,G,A,TTG
Primary Allele: TGSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACTTTTTATTTTTTATATTTTCATAAATTTTTTGAATAAGACGAGTGGTCAAACTCTATAGGTAAAAACTCAAAATCCCTTATATTATGAAATTTTTT[T/TG,TA,G,A,TTG]
AATAAGACGAGTGGTCAAACTCTATAAATAAAAATTCAAAATCCTAATATTATGAGACGGAGGGAGTAGTCCACAGCAAATAGGGTAATTTAGATACATG

Reverse complement sequence

CATGTATCTAAATTACCCTATTTGCTGTGGACTACTCCCTCCGTCTCATAATATTAGGATTTTGAATTTTTATTTATAGAGTTTGACCACTCGTCTTATT[A/CA,TA,C,T,CAA]
AAAAAATTTCATAATATAAGGGATTTTGAGTTTTTACCTATAGAGTTTGACCACTCGTCTTATTCAAAAAATTTATGAAAATATAAAAAATAAAAAGTTG

Allele Frequencies:

Populations Population SizeFrequency of TG(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 40.20% 0.47% 0.00% TA: 13.58%; G: 4.91%; A: 0.04%; TTG: 0.02%
All Indica  2759 65.50% 5.30% 0.58% 0.00% TA: 22.36%; G: 6.31%; A: 0.04%
All Japonica  1512 0.80% 95.00% 0.00% 0.00% G: 3.11%; TA: 0.99%; TTG: 0.07%
Aus  269 26.80% 71.70% 1.12% 0.00% G: 0.37%
Indica I  595 61.00% 0.50% 0.17% 0.00% TA: 33.11%; G: 5.21%
Indica II  465 31.60% 9.20% 1.29% 0.00% TA: 34.41%; G: 23.23%; A: 0.22%
Indica III  913 93.60% 3.10% 0.33% 0.00% TA: 2.63%; G: 0.33%
Indica Intermediate  786 56.10% 9.00% 0.76% 0.00% TA: 30.03%; G: 4.07%
Temperate Japonica  767 0.40% 94.50% 0.00% 0.00% G: 3.52%; TA: 1.56%
Tropical Japonica  504 1.40% 97.00% 0.00% 0.00% G: 1.39%; TA: 0.20%
Japonica Intermediate  241 0.80% 92.50% 0.00% 0.00% G: 5.39%; TA: 0.83%; TTG: 0.41%
VI/Aromatic  96 6.20% 86.50% 1.04% 0.00% G: 5.21%; A: 1.04%
Intermediate  90 32.20% 48.90% 2.22% 0.00% TA: 11.11%; G: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804605906 T -> TA LOC_Os08g08110.1 upstream_gene_variant ; 1193.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TA LOC_Os08g08120.1 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TA LOC_Os08g08120.3 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TA LOC_Os08g08120.2 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TA LOC_Os08g08110-LOC_Os08g08120 intergenic_region ; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TG LOC_Os08g08110.1 upstream_gene_variant ; 1193.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TG LOC_Os08g08120.1 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TG LOC_Os08g08120.3 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TG LOC_Os08g08120.2 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TG LOC_Os08g08110-LOC_Os08g08120 intergenic_region ; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> A LOC_Os08g08110.1 upstream_gene_variant ; 1192.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> A LOC_Os08g08120.1 downstream_gene_variant ; 4594.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> A LOC_Os08g08120.3 downstream_gene_variant ; 4594.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> A LOC_Os08g08120.2 downstream_gene_variant ; 4594.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> A LOC_Os08g08110-LOC_Os08g08120 intergenic_region ; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TTG LOC_Os08g08110.1 upstream_gene_variant ; 1193.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TTG LOC_Os08g08120.1 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TTG LOC_Os08g08120.3 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TTG LOC_Os08g08120.2 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> TTG LOC_Os08g08110-LOC_Os08g08120 intergenic_region ; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> G LOC_Os08g08110.1 upstream_gene_variant ; 1192.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> G LOC_Os08g08120.1 downstream_gene_variant ; 4594.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> G LOC_Os08g08120.3 downstream_gene_variant ; 4594.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> G LOC_Os08g08120.2 downstream_gene_variant ; 4594.0bp to feature; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N
vg0804605906 T -> G LOC_Os08g08110-LOC_Os08g08120 intergenic_region ; MODIFIER silent_mutation Average:74.711; most accessible tissue: Minghui63 flower, score: 94.203 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804605906 T A -0.02 -0.02 -0.01 -0.01 -0.02 -0.02
vg0804605906 T G -0.1 -0.06 -0.05 -0.03 -0.04 -0.08
vg0804605906 T TA -0.24 -0.2 -0.15 -0.08 -0.18 -0.19
vg0804605906 T TG -0.29 -0.26 -0.19 -0.09 -0.19 -0.22
vg0804605906 T TTG -0.44 0.02 0.09 -0.05 0.03 0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804605906 NA 2.58E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 3.64E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 1.77E-08 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 1.48E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 1.99E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 9.07E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 3.18E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 5.70E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 1.17E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 6.56E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 1.83E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 1.87E-07 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 4.20E-06 NA mr1695 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 NA 1.27E-06 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 3.55E-06 NA mr1817 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804605906 2.87E-07 5.48E-07 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251