\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804583372:

Variant ID: vg0804583372 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4583372
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TTTATAGGTGTTTTCTTTTTATGAAATTCTTATGTAGTAAATTCTTTGGAGAGCGCTACAAATATCGCATGGTGTTGCCGCGCATGTAGAGTACTGTTTC[T/A]
CTAACCAATAAAAAATGTTTCAACAAAAATGTATCAGTTATGTGTATCTTGAAAATAAAAAATGTTTCGTTACTCTTGAGAAATGTTTCATCGATCGGGT

Reverse complement sequence

ACCCGATCGATGAAACATTTCTCAAGAGTAACGAAACATTTTTTATTTTCAAGATACACATAACTGATACATTTTTGTTGAAACATTTTTTATTGGTTAG[A/T]
GAAACAGTACTCTACATGCGCGGCAACACCATGCGATATTTGTAGCGCTCTCCAAAGAATTTACTACATAAGAATTTCATAAAAAGAAAACACCTATAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 28.00% 0.21% 0.00% NA
All Indica  2759 93.40% 6.60% 0.04% 0.00% NA
All Japonica  1512 25.70% 73.70% 0.60% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.50% 5.50% 0.00% 0.00% NA
Indica II  465 76.10% 23.70% 0.22% 0.00% NA
Indica III  913 99.30% 0.70% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 4.20% 0.00% 0.00% NA
Temperate Japonica  767 17.10% 81.90% 1.04% 0.00% NA
Tropical Japonica  504 23.60% 76.40% 0.00% 0.00% NA
Japonica Intermediate  241 57.70% 41.90% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804583372 T -> A LOC_Os08g08070.1 3_prime_UTR_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0804583372 T -> A LOC_Os08g08080.1 upstream_gene_variant ; 3106.0bp to feature; MODIFIER silent_mutation Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0804583372 T -> A LOC_Os08g08080.2 upstream_gene_variant ; 3111.0bp to feature; MODIFIER silent_mutation Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg0804583372 T -> A LOC_Os08g08060.1 downstream_gene_variant ; 2627.0bp to feature; MODIFIER silent_mutation Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804583372 NA 1.33E-07 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 3.79E-07 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 8.94E-08 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 1.02E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 6.60E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 5.10E-07 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 7.94E-09 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 1.88E-07 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 1.73E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 1.14E-06 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 1.83E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 NA 1.18E-06 mr1599 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804583372 1.62E-07 2.62E-07 mr1817 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251