Variant ID: vg0804583372 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 4583372 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.08, others allele: 0.00, population size: 195. )
TTTATAGGTGTTTTCTTTTTATGAAATTCTTATGTAGTAAATTCTTTGGAGAGCGCTACAAATATCGCATGGTGTTGCCGCGCATGTAGAGTACTGTTTC[T/A]
CTAACCAATAAAAAATGTTTCAACAAAAATGTATCAGTTATGTGTATCTTGAAAATAAAAAATGTTTCGTTACTCTTGAGAAATGTTTCATCGATCGGGT
ACCCGATCGATGAAACATTTCTCAAGAGTAACGAAACATTTTTTATTTTCAAGATACACATAACTGATACATTTTTGTTGAAACATTTTTTATTGGTTAG[A/T]
GAAACAGTACTCTACATGCGCGGCAACACCATGCGATATTTGTAGCGCTCTCCAAAGAATTTACTACATAAGAATTTCATAAAAAGAAAACACCTATAAA
Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 71.80% | 28.00% | 0.21% | 0.00% | NA |
All Indica | 2759 | 93.40% | 6.60% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 25.70% | 73.70% | 0.60% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 76.10% | 23.70% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 17.10% | 81.90% | 1.04% | 0.00% | NA |
Tropical Japonica | 504 | 23.60% | 76.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 57.70% | 41.90% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0804583372 | T -> A | LOC_Os08g08070.1 | 3_prime_UTR_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
vg0804583372 | T -> A | LOC_Os08g08080.1 | upstream_gene_variant ; 3106.0bp to feature; MODIFIER | silent_mutation | Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
vg0804583372 | T -> A | LOC_Os08g08080.2 | upstream_gene_variant ; 3111.0bp to feature; MODIFIER | silent_mutation | Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
vg0804583372 | T -> A | LOC_Os08g08060.1 | downstream_gene_variant ; 2627.0bp to feature; MODIFIER | silent_mutation | Average:42.325; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0804583372 | NA | 1.33E-07 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 3.79E-07 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 8.94E-08 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 1.02E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 6.60E-06 | mr1235 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 5.10E-07 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 7.94E-09 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 1.88E-07 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 1.73E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 1.14E-06 | mr1435 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 1.83E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | NA | 1.18E-06 | mr1599 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0804583372 | 1.62E-07 | 2.62E-07 | mr1817 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |