Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0804420926:

Variant ID: vg0804420926 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4420926
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.82, G: 0.18, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAGTCAATACTTAGAGCAAGTTTAATAGTATAGCCAACGACTAGCTCCAAATCATCTATAGCTAATCTAATAACACATTCATACAATAGTTAACTAT[G/A]
AAAAAATACTACATCATTAGAGCAAGTTTAATAGTATAGCCAACTACTAGCTCCAATACATCTATAACCAATCTAATAGCTTATTCATACAATAGTTACA

Reverse complement sequence

TGTAACTATTGTATGAATAAGCTATTAGATTGGTTATAGATGTATTGGAGCTAGTAGTTGGCTATACTATTAAACTTGCTCTAATGATGTAGTATTTTTT[C/T]
ATAGTTAACTATTGTATGAATGTGTTATTAGATTAGCTATAGATGATTTGGAGCTAGTCGTTGGCTATACTATTAAACTTGCTCTAAGTATTGACTATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.20%	23.70%	1.06%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.00%	0.00%	NA
All Japonica	1512	28.20%	68.70%	3.11%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	94.50%	5.50%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	2.30%	0.00%	0.00%	NA
Temperate Japonica	767	23.10%	72.60%	4.30%	0.00%	NA
Tropical Japonica	504	27.40%	72.20%	0.40%	0.00%	NA
Japonica Intermediate	241	46.10%	49.00%	4.98%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	78.90%	18.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804420926	G -> A	LOC_Os08g07850.1	upstream_gene_variant ; 4002.0bp to feature; MODIFIER	silent_mutation	Average:67.216; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0804420926	G -> A	LOC_Os08g07860.1	downstream_gene_variant ; 504.0bp to feature; MODIFIER	silent_mutation	Average:67.216; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0804420926	G -> A	LOC_Os08g07870.1	downstream_gene_variant ; 4059.0bp to feature; MODIFIER	silent_mutation	Average:67.216; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N
vg0804420926	G -> A	LOC_Os08g07850-LOC_Os08g07860	intergenic_region ; MODIFIER	silent_mutation	Average:67.216; most accessible tissue: Zhenshan97 panicle, score: 85.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804420926	NA	9.98E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	3.07E-06	NA	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	NA	4.54E-07	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	NA	5.56E-10	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	NA	5.16E-08	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	3.23E-08	NA	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	4.12E-07	2.94E-08	mr1174_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	2.43E-07	NA	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	1.18E-07	3.70E-07	mr1347_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804420926	NA	1.61E-09	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251