\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804315269:

Variant ID: vg0804315269 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4315269
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAGCAAGAACGCAGATAGCAATGACGTGGTCTAGATAGAGAGAGAAATGACAACAACGAGCTCTGGTAATAAACACGACCAGATGAGTGTATCAAAACG[C/A]
ATTCCCAAATAAGGGGGTTCCGTTTTCCTTGAATGTGTAGGAAGAACAAAGATGGAGAAAAAACGACTAACACTATTCATTGTCTTCCCTAGCATAAACA

Reverse complement sequence

TGTTTATGCTAGGGAAGACAATGAATAGTGTTAGTCGTTTTTTCTCCATCTTTGTTCTTCCTACACATTCAAGGAAAACGGAACCCCCTTATTTGGGAAT[G/T]
CGTTTTGATACACTCATCTGGTCGTGTTTATTACCAGAGCTCGTTGTTGTCATTTCTCTCTCTATCTAGACCACGTCATTGCTATCTGCGTTCTTGCTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.40% 0.00% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 56.70% 43.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 58.70% 41.30% 0.00% 0.00% NA
Tropical Japonica  504 69.80% 30.20% 0.00% 0.00% NA
Japonica Intermediate  241 22.80% 77.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804315269 C -> A LOC_Os08g07710.1 downstream_gene_variant ; 3198.0bp to feature; MODIFIER silent_mutation Average:68.626; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg0804315269 C -> A LOC_Os08g07720.1 downstream_gene_variant ; 891.0bp to feature; MODIFIER silent_mutation Average:68.626; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N
vg0804315269 C -> A LOC_Os08g07710-LOC_Os08g07720 intergenic_region ; MODIFIER silent_mutation Average:68.626; most accessible tissue: Minghui63 flag leaf, score: 83.621 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804315269 4.34E-07 NA mr1036 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 8.62E-06 4.58E-06 mr1036 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 8.10E-18 1.03E-18 mr1174 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 3.10E-13 6.83E-16 mr1174 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 NA 4.37E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 4.30E-11 6.67E-07 mr1347 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 6.39E-09 6.39E-09 mr1347 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 NA 9.87E-06 mr1508 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 NA 8.78E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 NA 2.65E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 2.68E-16 6.75E-14 mr1174_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 6.47E-11 2.28E-11 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 5.94E-11 NA mr1347_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804315269 1.64E-07 NA mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251