Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804311745:

Variant ID: vg0804311745 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4311745
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGTAGGGACCTGGGACCCATGACCCCACGTCGTCCCTAGCAGGCAGCTCGGGGGAAAAACGCCACCCCACTCCTCCACCACTCCCTCCGTCTTGCCAC[T/C]
GCAAGAGCAATCCGCCAGTCATCGTGCGGTGAGCCGAGATGGCGGAGGTGAGGCTAGACCCCGGCGGTGAGCCAACGCAAGGAAATCAAGGCGATGTTGG

Reverse complement sequence

CCAACATCGCCTTGATTTCCTTGCGTTGGCTCACCGCCGGGGTCTAGCCTCACCTCCGCCATCTCGGCTCACCGCACGATGACTGGCGGATTGCTCTTGC[A/G]
GTGGCAAGACGGAGGGAGTGGTGGAGGAGTGGGGTGGCGTTTTTCCCCCGAGCTGCCTGCTAGGGACGACGTGGGGTCATGGGTCCCAGGTCCCTACATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.70%	14.20%	1.06%	0.00%	NA
All Indica	2759	99.10%	0.70%	0.22%	0.00%	NA
All Japonica	1512	55.10%	42.10%	2.84%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.20%	1.20%	0.67%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	0.90%	0.25%	0.00%	NA
Temperate Japonica	767	54.20%	41.10%	4.69%	0.00%	NA
Tropical Japonica	504	44.20%	55.00%	0.79%	0.00%	NA
Japonica Intermediate	241	80.50%	18.30%	1.24%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	88.90%	10.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804311745	T -> C	LOC_Os08g07710.1	upstream_gene_variant ; 39.0bp to feature; MODIFIER	silent_mutation	Average:66.562; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0804311745	T -> C	LOC_Os08g07720.1	downstream_gene_variant ; 4415.0bp to feature; MODIFIER	silent_mutation	Average:66.562; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N
vg0804311745	T -> C	LOC_Os08g07700-LOC_Os08g07710	intergenic_region ; MODIFIER	silent_mutation	Average:66.562; most accessible tissue: Zhenshan97 young leaf, score: 80.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804311745	3.74E-07	NA	mr1036	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	5.83E-06	1.08E-06	mr1036	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	1.12E-10	NA	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	2.38E-08	7.57E-12	mr1174	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	1.87E-08	NA	mr1347	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	6.90E-08	6.90E-08	mr1347	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	1.60E-06	NA	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	NA	4.95E-07	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	NA	8.32E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	6.89E-06	NA	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	6.00E-06	NA	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804311745	6.24E-07	1.52E-10	mr1806_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251