\
| Variant ID: vg0804261000 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4261000 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )
ACCAGTGTTATGTCCTGGGACTGATATTGAGATCGCGGTTTCGTAGGAAGCGGTTCGCGCCCTTTTTCCTACGACACGCTCATGTCAGGTGTGCCATTGT[T/A]
CGGCGGTGCTAGATTGGGGTGTGACAGGTTGCCCCCACACCCTCACCCATGTGAGGTTCAAATTTCACCGACCCCGTCCCCGCCAATCATGATGGGGATA
TATCCCCATCATGATTGGCGGGGACGGGGTCGGTGAAATTTGAACCTCACATGGGTGAGGGTGTGGGGGCAACCTGTCACACCCCAATCTAGCACCGCCG[A/T]
ACAATGGCACACCTGACATGAGCGTGTCGTAGGAAAAAGGGCGCGAACCGCTTCCTACGAAACCGCGATCTCAATATCAGTCCCAGGACATAACACTGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.60% | 26.10% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 82.30% | 17.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 52.40% | 46.80% | 0.79% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.10% | 9.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 40.40% | 59.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 80.70% | 19.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 45.00% | 54.00% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 52.60% | 47.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 23.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804261000 | T -> A | LOC_Os08g07570.1 | upstream_gene_variant ; 4669.0bp to feature; MODIFIER | silent_mutation | Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0804261000 | T -> A | LOC_Os08g07590.1 | upstream_gene_variant ; 2883.0bp to feature; MODIFIER | silent_mutation | Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| vg0804261000 | T -> A | LOC_Os08g07570-LOC_Os08g07590 | intergenic_region ; MODIFIER | silent_mutation | Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804261000 | 1.71E-06 | 6.50E-07 | mr1174 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804261000 | NA | 5.49E-06 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804261000 | NA | 3.40E-10 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804261000 | 9.45E-06 | 1.66E-06 | mr1174_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804261000 | 5.78E-06 | NA | mr1347_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804261000 | NA | 6.45E-06 | mr1510_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804261000 | 2.24E-06 | NA | mr1806_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |