\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804261000:

Variant ID: vg0804261000 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4261000
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAGTGTTATGTCCTGGGACTGATATTGAGATCGCGGTTTCGTAGGAAGCGGTTCGCGCCCTTTTTCCTACGACACGCTCATGTCAGGTGTGCCATTGT[T/A]
CGGCGGTGCTAGATTGGGGTGTGACAGGTTGCCCCCACACCCTCACCCATGTGAGGTTCAAATTTCACCGACCCCGTCCCCGCCAATCATGATGGGGATA

Reverse complement sequence

TATCCCCATCATGATTGGCGGGGACGGGGTCGGTGAAATTTGAACCTCACATGGGTGAGGGTGTGGGGGCAACCTGTCACACCCCAATCTAGCACCGCCG[A/T]
ACAATGGCACACCTGACATGAGCGTGTCGTAGGAAAAAGGGCGCGAACCGCTTCCTACGAAACCGCGATCTCAATATCAGTCCCAGGACATAACACTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 26.10% 0.30% 0.00% NA
All Indica  2759 82.30% 17.70% 0.07% 0.00% NA
All Japonica  1512 52.40% 46.80% 0.79% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 90.10% 9.70% 0.17% 0.00% NA
Indica II  465 40.40% 59.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 80.70% 19.20% 0.13% 0.00% NA
Temperate Japonica  767 45.00% 54.00% 1.04% 0.00% NA
Tropical Japonica  504 52.60% 47.00% 0.40% 0.00% NA
Japonica Intermediate  241 75.90% 23.20% 0.83% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804261000 T -> A LOC_Os08g07570.1 upstream_gene_variant ; 4669.0bp to feature; MODIFIER silent_mutation Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0804261000 T -> A LOC_Os08g07590.1 upstream_gene_variant ; 2883.0bp to feature; MODIFIER silent_mutation Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0804261000 T -> A LOC_Os08g07570-LOC_Os08g07590 intergenic_region ; MODIFIER silent_mutation Average:67.379; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804261000 1.71E-06 6.50E-07 mr1174 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000 NA 5.49E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000 NA 3.40E-10 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000 9.45E-06 1.66E-06 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000 5.78E-06 NA mr1347_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000 NA 6.45E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804261000 2.24E-06 NA mr1806_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251