\
| Variant ID: vg0804091298 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4091298 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 107. )
ACAAGGCAAAGGGCCTGTTTGGGGGAGCTTTAGGGGCTGTTTGGTTCGCATCCTGATGCTTGCATGCCTGGCCGGAGCGCTGCCTGAGCTCCAACAACTA[C/T]
GTGTTTGGTTTGTGCCCTGGTGTATCCTAAGCTAGCTTGACCTGACTCTTCATTAGCCTGCTAAATCCTCAGGCAACTTCATTAGCCTGAGCCAGGCCAT
ATGGCCTGGCTCAGGCTAATGAAGTTGCCTGAGGATTTAGCAGGCTAATGAAGAGTCAGGTCAAGCTAGCTTAGGATACACCAGGGCACAAACCAAACAC[G/A]
TAGTTGTTGGAGCTCAGGCAGCGCTCCGGCCAGGCATGCAAGCATCAGGATGCGAACCAAACAGCCCCTAAAGCTCCCCCAAACAGGCCCTTTGCCTTGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.10% | 32.90% | 12.99% | 19.02% | NA |
| All Indica | 2759 | 11.10% | 46.30% | 11.82% | 30.77% | NA |
| All Japonica | 1512 | 81.70% | 1.50% | 14.35% | 2.45% | NA |
| Aus | 269 | 18.20% | 73.60% | 7.06% | 1.12% | NA |
| Indica I | 595 | 5.40% | 36.30% | 5.88% | 52.44% | NA |
| Indica II | 465 | 32.90% | 19.80% | 34.62% | 12.69% | NA |
| Indica III | 913 | 2.40% | 62.00% | 3.61% | 31.98% | NA |
| Indica Intermediate | 786 | 12.70% | 51.30% | 12.34% | 23.66% | NA |
| Temperate Japonica | 767 | 78.70% | 2.20% | 16.69% | 2.35% | NA |
| Tropical Japonica | 504 | 85.30% | 0.60% | 11.31% | 2.78% | NA |
| Japonica Intermediate | 241 | 83.80% | 0.80% | 13.28% | 2.07% | NA |
| VI/Aromatic | 96 | 29.20% | 33.30% | 37.50% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 26.70% | 17.78% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804091298 | C -> T | LOC_Os08g07300.1 | downstream_gene_variant ; 2344.0bp to feature; MODIFIER | silent_mutation | Average:53.248; most accessible tissue: Minghui63 root, score: 81.14 | N | N | N | N |
| vg0804091298 | C -> T | LOC_Os08g07300-LOC_Os08g07320 | intergenic_region ; MODIFIER | silent_mutation | Average:53.248; most accessible tissue: Minghui63 root, score: 81.14 | N | N | N | N |
| vg0804091298 | C -> DEL | N | N | silent_mutation | Average:53.248; most accessible tissue: Minghui63 root, score: 81.14 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804091298 | 2.38E-06 | 5.60E-10 | Heading_date | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0804091298 | NA | 3.30E-14 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0804091298 | NA | 6.16E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 1.45E-07 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 4.91E-06 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 2.26E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 1.02E-06 | mr1511_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 1.86E-12 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 1.04E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 1.39E-08 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 2.20E-09 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 1.47E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804091298 | NA | 2.06E-17 | mr1874_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |