\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804091298:

Variant ID: vg0804091298 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4091298
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGGCAAAGGGCCTGTTTGGGGGAGCTTTAGGGGCTGTTTGGTTCGCATCCTGATGCTTGCATGCCTGGCCGGAGCGCTGCCTGAGCTCCAACAACTA[C/T]
GTGTTTGGTTTGTGCCCTGGTGTATCCTAAGCTAGCTTGACCTGACTCTTCATTAGCCTGCTAAATCCTCAGGCAACTTCATTAGCCTGAGCCAGGCCAT

Reverse complement sequence

ATGGCCTGGCTCAGGCTAATGAAGTTGCCTGAGGATTTAGCAGGCTAATGAAGAGTCAGGTCAAGCTAGCTTAGGATACACCAGGGCACAAACCAAACAC[G/A]
TAGTTGTTGGAGCTCAGGCAGCGCTCCGGCCAGGCATGCAAGCATCAGGATGCGAACCAAACAGCCCCTAAAGCTCCCCCAAACAGGCCCTTTGCCTTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.10% 32.90% 12.99% 19.02% NA
All Indica  2759 11.10% 46.30% 11.82% 30.77% NA
All Japonica  1512 81.70% 1.50% 14.35% 2.45% NA
Aus  269 18.20% 73.60% 7.06% 1.12% NA
Indica I  595 5.40% 36.30% 5.88% 52.44% NA
Indica II  465 32.90% 19.80% 34.62% 12.69% NA
Indica III  913 2.40% 62.00% 3.61% 31.98% NA
Indica Intermediate  786 12.70% 51.30% 12.34% 23.66% NA
Temperate Japonica  767 78.70% 2.20% 16.69% 2.35% NA
Tropical Japonica  504 85.30% 0.60% 11.31% 2.78% NA
Japonica Intermediate  241 83.80% 0.80% 13.28% 2.07% NA
VI/Aromatic  96 29.20% 33.30% 37.50% 0.00% NA
Intermediate  90 44.40% 26.70% 17.78% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804091298 C -> T LOC_Os08g07300.1 downstream_gene_variant ; 2344.0bp to feature; MODIFIER silent_mutation Average:53.248; most accessible tissue: Minghui63 root, score: 81.14 N N N N
vg0804091298 C -> T LOC_Os08g07300-LOC_Os08g07320 intergenic_region ; MODIFIER silent_mutation Average:53.248; most accessible tissue: Minghui63 root, score: 81.14 N N N N
vg0804091298 C -> DEL N N silent_mutation Average:53.248; most accessible tissue: Minghui63 root, score: 81.14 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804091298 2.38E-06 5.60E-10 Heading_date Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804091298 NA 3.30E-14 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804091298 NA 6.16E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 1.45E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 4.91E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 2.26E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 1.02E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 1.86E-12 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 1.04E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 1.39E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 2.20E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 1.47E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804091298 NA 2.06E-17 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251