\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803730363:

Variant ID: vg0803730363 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3730363
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAATTGTGTATTAAATATTTTATGATTAATTGTGTATTAAATATTTTAGACTTAAAAATTAATTTTTGAGAGAAGAGAAAAGGAGAAGATTGAACAGA[T/C]
GCGCAAAACAAGGTGAACGATTAACTATGATTATTTGTTTACTAATTATTCCAAACTTAAAAAAACAAATTAATATGATTTATTAAATCAACTTTTTAAA

Reverse complement sequence

TTTAAAAAGTTGATTTAATAAATCATATTAATTTGTTTTTTTAAGTTTGGAATAATTAGTAAACAAATAATCATAGTTAATCGTTCACCTTGTTTTGCGC[A/G]
TCTGTTCAATCTTCTCCTTTTCTCTTCTCTCAAAAATTAATTTTTAAGTCTAAAATATTTAATACACAATTAATCATAAAATATTTAATACACAATTAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.80% 0.55% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 86.80% 11.60% 1.59% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 82.90% 14.60% 2.48% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 74.70% 23.20% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803730363 T -> C LOC_Os08g06600.1 upstream_gene_variant ; 4117.0bp to feature; MODIFIER silent_mutation Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg0803730363 T -> C LOC_Os08g06620.1 upstream_gene_variant ; 1519.0bp to feature; MODIFIER silent_mutation Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg0803730363 T -> C LOC_Os08g06630.1 upstream_gene_variant ; 2078.0bp to feature; MODIFIER silent_mutation Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg0803730363 T -> C LOC_Os08g06630.3 upstream_gene_variant ; 2152.0bp to feature; MODIFIER silent_mutation Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg0803730363 T -> C LOC_Os08g06610.1 downstream_gene_variant ; 2902.0bp to feature; MODIFIER silent_mutation Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N
vg0803730363 T -> C LOC_Os08g06620-LOC_Os08g06630 intergenic_region ; MODIFIER silent_mutation Average:35.07; most accessible tissue: Minghui63 flag leaf, score: 48.324 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803730363 3.51E-07 NA mr1300 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803730363 3.88E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803730363 8.88E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803730363 2.98E-06 2.98E-06 mr1445_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251