Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0802999614:

Variant ID: vg0802999614 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2999614
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTGTTCTGGGAAGATTGTTGGCTGCAGGGCGCTTCAATTCGGTCGCTGGCACTGGCTGTTTGGGCGGCTGTCCCAGGGCGGTTGCGGGGCAAACGCAC[G/A]
GTGTCTGAGGCGCTACACGACAGGAGATAGATTCGTGATATCTCCTCGGCGTTAGGGATGCAAGCGATCCTTGAATACTTCAAGCTCTGGGAGCTCCTCC

Reverse complement sequence

GGAGGAGCTCCCAGAGCTTGAAGTATTCAAGGATCGCTTGCATCCCTAACGCCGAGGAGATATCACGAATCTATCTCCTGTCGTGTAGCGCCTCAGACAC[C/T]
GTGCGTTTGCCCCGCAACCGCCCTGGGACAGCCGCCCAAACAGCCAGTGCCAGCGACCGAATTGAAGCGCCCTGCAGCCAACAATCTTCCCAGAACAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.50%	12.00%	2.92%	0.59%	NA
All Indica	2759	73.60%	20.40%	4.93%	0.98%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	64.50%	24.40%	10.08%	1.01%	NA
Indica II	465	85.60%	8.80%	3.01%	2.58%	NA
Indica III	913	66.20%	29.70%	4.16%	0.00%	NA
Indica Intermediate	786	82.20%	13.60%	3.05%	1.15%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	2.20%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802999614	G -> A	LOC_Os08g05600.1	downstream_gene_variant ; 1157.0bp to feature; MODIFIER	silent_mutation	Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N
vg0802999614	G -> A	LOC_Os08g05610.1	downstream_gene_variant ; 816.0bp to feature; MODIFIER	silent_mutation	Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N
vg0802999614	G -> A	LOC_Os08g05600-LOC_Os08g05610	intergenic_region ; MODIFIER	silent_mutation	Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N
vg0802999614	G -> DEL	N	N	silent_mutation	Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802999614	NA	2.56E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999614	4.92E-06	4.92E-06	mr1449	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999614	NA	3.01E-06	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251