\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802999614:

Variant ID: vg0802999614 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2999614
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGTTCTGGGAAGATTGTTGGCTGCAGGGCGCTTCAATTCGGTCGCTGGCACTGGCTGTTTGGGCGGCTGTCCCAGGGCGGTTGCGGGGCAAACGCAC[G/A]
GTGTCTGAGGCGCTACACGACAGGAGATAGATTCGTGATATCTCCTCGGCGTTAGGGATGCAAGCGATCCTTGAATACTTCAAGCTCTGGGAGCTCCTCC

Reverse complement sequence

GGAGGAGCTCCCAGAGCTTGAAGTATTCAAGGATCGCTTGCATCCCTAACGCCGAGGAGATATCACGAATCTATCTCCTGTCGTGTAGCGCCTCAGACAC[C/T]
GTGCGTTTGCCCCGCAACCGCCCTGGGACAGCCGCCCAAACAGCCAGTGCCAGCGACCGAATTGAAGCGCCCTGCAGCCAACAATCTTCCCAGAACAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 12.00% 2.92% 0.59% NA
All Indica  2759 73.60% 20.40% 4.93% 0.98% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 64.50% 24.40% 10.08% 1.01% NA
Indica II  465 85.60% 8.80% 3.01% 2.58% NA
Indica III  913 66.20% 29.70% 4.16% 0.00% NA
Indica Intermediate  786 82.20% 13.60% 3.05% 1.15% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 2.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802999614 G -> A LOC_Os08g05600.1 downstream_gene_variant ; 1157.0bp to feature; MODIFIER silent_mutation Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N
vg0802999614 G -> A LOC_Os08g05610.1 downstream_gene_variant ; 816.0bp to feature; MODIFIER silent_mutation Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N
vg0802999614 G -> A LOC_Os08g05600-LOC_Os08g05610 intergenic_region ; MODIFIER silent_mutation Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N
vg0802999614 G -> DEL N N silent_mutation Average:58.528; most accessible tissue: Zhenshan97 flag leaf, score: 84.726 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802999614 NA 2.56E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999614 4.92E-06 4.92E-06 mr1449 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802999614 NA 3.01E-06 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251