\
| Variant ID: vg0802714869 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2714869 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
CCATCCGATAAGACCATAATGCTTCGGCTAAACGAATATGCTATTGCCGAGGATAATCAGAAATCTTCCTCTTAATCAATTTGATCAAGCACTTGTAGAT[G/T]
CCTCGGCCTGCCCATTAGCTTGTGCATAATGCGGTGAAGAATTCAATAATTTGATACCCATGCTATCGGAAAACTGAACAAACTCATCAGACACGAAAAT
ATTTTCGTGTCTGATGAGTTTGTTCAGTTTTCCGATAGCATGGGTATCAAATTATTGAATTCTTCACCGCATTATGCACAAGCTAATGGGCAGGCCGAGG[C/A]
ATCTACAAGTGCTTGATCAAATTGATTAAGAGGAAGATTTCTGATTATCCTCGGCAATAGCATATTCGTTTAGCCGAAGCATTATGGTCTTATCGGATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 39.30% | 7.02% | 0.00% | NA |
| All Indica | 2759 | 33.30% | 56.50% | 10.22% | 0.00% | NA |
| All Japonica | 1512 | 80.70% | 16.50% | 2.84% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.30% | 71.60% | 16.13% | 0.00% | NA |
| Indica II | 465 | 19.40% | 73.30% | 7.31% | 0.00% | NA |
| Indica III | 913 | 49.80% | 39.00% | 11.17% | 0.00% | NA |
| Indica Intermediate | 786 | 38.30% | 55.30% | 6.36% | 0.00% | NA |
| Temperate Japonica | 767 | 97.70% | 1.20% | 1.17% | 0.00% | NA |
| Tropical Japonica | 504 | 54.00% | 41.70% | 4.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 12.40% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 50.00% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802714869 | G -> T | LOC_Os08g05210.1 | downstream_gene_variant ; 925.0bp to feature; MODIFIER | silent_mutation | Average:32.461; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| vg0802714869 | G -> T | LOC_Os08g05220.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.461; most accessible tissue: Zhenshan97 young leaf, score: 52.657 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802714869 | NA | 7.67E-10 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0802714869 | NA | 1.37E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 1.89E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 3.60E-17 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 8.92E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 3.87E-11 | mr1784 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 8.67E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 5.35E-10 | mr1862 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 1.35E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 2.60E-24 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 9.79E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 1.72E-17 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802714869 | NA | 7.26E-11 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |