\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802260819:

Variant ID: vg0802260819 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 2260819
Reference Allele: TAlternative Allele: A,TAAA,TA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, T: 0.21, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTGTGGTTCCTAAGTTTAACAAATTTTAAAGAAAAAGTTTAACAAATTTAAAACCCCATCCCTATACATACTTGGCAAATATTTACTTAATTTTTT[T/A,TAAA,TA]
AAAAAACATAGAATGTACATGAAACTTTTAGTTGTTGATTTGTTGATTAAGGTTGTCAGTTTAACTTTTCACTACTTTGAAAAATATTATCTCAGATATA

Reverse complement sequence

TATATCTGAGATAATATTTTTCAAAGTAGTGAAAAGTTAAACTGACAACCTTAATCAACAAATCAACAACTAAAAGTTTCATGTACATTCTATGTTTTTT[A/T,TTTA,TA]
AAAAAATTAAGTAAATATTTGCCAAGTATGTATAGGGATGGGGTTTTAAATTTGTTAAACTTTTTCTTTAAAATTTGTTAAACTTAGGAACCACAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.20% 32.60% 0.21% 0.00% TA: 3.64%; TAAA: 2.29%
All Indica  2759 95.40% 1.10% 0.11% 0.00% TA: 2.97%; TAAA: 0.40%
All Japonica  1512 10.30% 89.50% 0.13% 0.00% TA: 0.07%
Aus  269 20.10% 14.10% 1.49% 0.00% TAAA: 34.57%; TA: 29.74%
Indica I  595 99.30% 0.30% 0.17% 0.00% TA: 0.17%
Indica II  465 91.60% 1.70% 0.22% 0.00% TA: 6.24%; TAAA: 0.22%
Indica III  913 98.50% 0.20% 0.11% 0.00% TA: 0.88%; TAAA: 0.33%
Indica Intermediate  786 91.20% 2.30% 0.00% 0.00% TA: 5.60%; TAAA: 0.89%
Temperate Japonica  767 18.50% 81.20% 0.26% 0.00% NA
Tropical Japonica  504 1.20% 98.60% 0.00% 0.00% TA: 0.20%
Japonica Intermediate  241 3.30% 96.70% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 88.50% 0.00% 0.00% TA: 5.21%; TAAA: 2.08%
Intermediate  90 51.10% 41.10% 1.11% 0.00% TA: 4.44%; TAAA: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802260819 T -> TA LOC_Os08g04540.1 downstream_gene_variant ; 2900.0bp to feature; MODIFIER silent_mutation Average:30.221; most accessible tissue: Callus, score: 58.795 N N N N
vg0802260819 T -> TA LOC_Os08g04540-LOC_Os08g04550 intergenic_region ; MODIFIER silent_mutation Average:30.221; most accessible tissue: Callus, score: 58.795 N N N N
vg0802260819 T -> A LOC_Os08g04540.1 downstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:30.221; most accessible tissue: Callus, score: 58.795 N N N N
vg0802260819 T -> A LOC_Os08g04540-LOC_Os08g04550 intergenic_region ; MODIFIER silent_mutation Average:30.221; most accessible tissue: Callus, score: 58.795 N N N N
vg0802260819 T -> TAAA LOC_Os08g04540.1 downstream_gene_variant ; 2900.0bp to feature; MODIFIER silent_mutation Average:30.221; most accessible tissue: Callus, score: 58.795 N N N N
vg0802260819 T -> TAAA LOC_Os08g04540-LOC_Os08g04550 intergenic_region ; MODIFIER silent_mutation Average:30.221; most accessible tissue: Callus, score: 58.795 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802260819 NA 2.64E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802260819 NA 2.17E-17 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802260819 NA 9.58E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802260819 NA 1.60E-18 mr1552 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802260819 NA 3.94E-35 mr1793 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802260819 NA 1.11E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802260819 NA 1.23E-48 mr1793_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251