\
| Variant ID: vg0802210939 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2210939 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTACTCCTTTCGTCCTAAAATATAACAACTTTTAGCTCTCAAGATTTGTCCCAAAATATAACAACTTCTCCATCAACATTCTCTTCCCAACCAATCACAA[C/A]
TCTCCACCATTCACTTTTCCCACCTACCTTCACTATTTAATCAATTACAACCCTCCACCATTCACTTCTACTTGCTTTCTTAATAACCGTGTCTAACTCT
AGAGTTAGACACGGTTATTAAGAAAGCAAGTAGAAGTGAATGGTGGAGGGTTGTAATTGATTAAATAGTGAAGGTAGGTGGGAAAAGTGAATGGTGGAGA[G/T]
TTGTGATTGGTTGGGAAGAGAATGTTGATGGAGAAGTTGTTATATTTTGGGACAAATCTTGAGAGCTAAAAGTTGTTATATTTTAGGACGAAAGGAGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.00% | 19.10% | 1.46% | 0.47% | NA |
| All Indica | 2759 | 67.10% | 32.00% | 0.87% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 75.80% | 0.00% | 15.99% | 8.18% | NA |
| Indica I | 595 | 61.30% | 38.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 85.60% | 14.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 69.40% | 30.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 57.80% | 39.90% | 2.29% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802210939 | C -> A | LOC_Os08g04490.1 | downstream_gene_variant ; 1250.0bp to feature; MODIFIER | silent_mutation | Average:38.33; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0802210939 | C -> A | LOC_Os08g04500.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.33; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0802210939 | C -> A | LOC_Os08g04500.2 | intron_variant ; MODIFIER | silent_mutation | Average:38.33; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0802210939 | C -> DEL | N | N | silent_mutation | Average:38.33; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802210939 | NA | 3.65E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210939 | 8.31E-43 | 7.83E-68 | mr1739 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210939 | 9.72E-37 | 1.13E-65 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210939 | NA | 1.10E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210939 | 3.84E-46 | 9.97E-68 | mr1739_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210939 | 1.79E-43 | 6.86E-76 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |